Rorug06G0147100

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
21010474 .. 21010800
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0147100.1

Sequence Viewer

Length: 195 bp
ATGGTGGTTGTTATACGTACCGCGTACCGTAAAGACCAGCGTACCGCGTACCCGTATCGCGTATCCGTATCGAAACGTTCCGCGTTTCAGGTGACTTATCGCGCTGATTTTAGGAAGTCCGAACCGACCACATACATTAATGCACCATTTGTTGGTGTTTTGGCATACTTTGTGGCTAATCCCAGTCCAAACTAG

Protein Analysis

64

Amino Acids

7.37

Weight (kDa)

10.27

Isoelectric Point (pI)

30.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013120)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 152
AccII CGCG 5 cut(s) 23, 47, 60, 83, 102
AciI CCGC 3 cut(s) 21, 45, 81
AclI AACGTT 1 cut(s) 76
AfaI GTAC 4 cut(s) 19, 26, 43, 50
AfiI CCNNNNNNNGG 1 cut(s) 152
AseI ATTAAT 1 cut(s) 138
AspLEI GCGC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 103
BaeI ACNNNNGTAYC 2 cut(s) 25, 58
BciVI GTATCC 1 cut(s) 73
BfaI CTAG 1 cut(s) 193
BfuI GTATCC 1 cut(s) 73
BmrI ACTGGG 1 cut(s) 177
BmuI ACTGGG 1 cut(s) 177
BsaAI YACGTR 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 152
BseNI ACTGG 1 cut(s) 183
Bsh1236I CGCG 5 cut(s) 23, 47, 60, 83, 102
BslI CCNNNNNNNGG 1 cut(s) 152
BspACI CCGC 3 cut(s) 21, 45, 81
BspFNI CGCG 5 cut(s) 23, 47, 60, 83, 102
BsrI ACTGG 1 cut(s) 183
Bst4CI ACNGT 1 cut(s) 29
BstBAI YACGTR 1 cut(s) 17
BstFNI CGCG 5 cut(s) 23, 47, 60, 83, 102
BstHHI GCGC 1 cut(s) 104
BstSNI TACGTA 1 cut(s) 17
BstUI CGCG 5 cut(s) 23, 47, 60, 83, 102
BsuI GTATCC 1 cut(s) 73
CfoI GCGC 1 cut(s) 104
Csp6I GTAC 4 cut(s) 18, 25, 42, 49
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
CviQI GTAC 4 cut(s) 18, 25, 42, 49
Eco105I TACGTA 1 cut(s) 17
FaiI YATR 3 cut(s) 14, 133, 166
FspBI CTAG 1 cut(s) 193
GlaI GCGC 1 cut(s) 103
HhaI GCGC 1 cut(s) 104
Hin6I GCGC 1 cut(s) 102
HinP1I GCGC 1 cut(s) 102
HphI GGTGA 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 29
HpyCH4IV ACGT 2 cut(s) 16, 76
HpyCH4V TGCA 1 cut(s) 143
HpySE526I ACGT 2 cut(s) 16, 76
HspAI GCGC 1 cut(s) 102
LpnPI CCDG 2 cut(s) 50, 74
MaeI CTAG 1 cut(s) 193
MaeII ACGT 2 cut(s) 16, 76
MaeIII GTNAC 1 cut(s) 91
MseI TTAA 1 cut(s) 138
MvnI CGCG 5 cut(s) 23, 47, 60, 83, 102
NmuCI GTSAC 1 cut(s) 91
PflMI CCANNNNNTGG 1 cut(s) 152
Ppu21I YACGTR 1 cut(s) 17
PshBI ATTAAT 1 cut(s) 138
Psp1406I AACGTT 1 cut(s) 76
RsaI GTAC 4 cut(s) 19, 26, 43, 50
RsaNI GTAC 4 cut(s) 18, 25, 42, 49
SaqAI TTAA 1 cut(s) 138
SetI ASST 3 cut(s) 19, 79, 93
SgeI CNNG 8 cut(s) 34, 49, 58, 64, 71, 94, 101, 113
SnaBI TACGTA 1 cut(s) 17
SsiI CCGC 3 cut(s) 21, 45, 81
SspMI CTAG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 29
TaiI ACGT 2 cut(s) 19, 79
TaqI TCGA 1 cut(s) 71
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspGWI ACGGA 1 cut(s) 55
Van91I CCANNNNNTGG 1 cut(s) 152
VspI ATTAAT 1 cut(s) 138
XspI CTAG 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.