Rorug06G0148300

Poly(A)-specific ribonuclease PARN-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0009492
Physical Location & Seq
Forward (+)
21256817 .. 21257226
410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0148300.1

Sequence Viewer

Length: 270 bp
ATGTCTGTTAACTTTGAACAGAGTGCAGACTTCCTTGATCTGGAATCTGGCATTGACCTCTTGGTTTTACTTATTGCGGATGAGGAGCCTGGATTAGGGGGAATCAAGCTAGCCCGAAATTTATTGGAGGATAGTCCGTGGAATGTCAAAGGGTACTGTTTCTCAGTCTGTCATTGGCCCCGCTTCCATTCCATTGATGAACTTGAAATCAATCGAGCTACCTACTGGATCCAAGCTGTTAGGATCCCCAGGATCCAAGCCCAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0005488 GO:0043167 GO:0043169
KEGG Pathways
Metabolic & Signaling
ko03018 map03018
Pfam Domains
Protein Families
CAF1

Protein Analysis

89

Amino Acids

10.19

Weight (kDa)

4.63

Isoelectric Point (pI)

34.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 77, 181
AclWI GGATC 6 cut(s) 223, 236, 238, 247, 251, 260
AcsI RAATTY 1 cut(s) 118
AfaI GTAC 1 cut(s) 155
AfiI CCNNNNNNNGG 2 cut(s) 40, 95
AgsI TTSAA 2 cut(s) 17, 206
AjnI CCWGG 2 cut(s) 88, 248
AluBI AGCT 3 cut(s) 109, 218, 236
AluI AGCT 3 cut(s) 109, 218, 236
AlwI GGATC 6 cut(s) 223, 236, 238, 247, 251, 260
AoxI GGCC 1 cut(s) 176
ApoI RAATTY 1 cut(s) 118
AspS9I GGNCC 1 cut(s) 177
AsuNHI GCTAGC 1 cut(s) 109
BamHI GGATCC 3 cut(s) 228, 243, 252
BciT130I CCWGG 2 cut(s) 90, 250
BfaI CTAG 1 cut(s) 110
Bme1390I CCNGG 2 cut(s) 90, 250
BmgT120I GGNCC 1 cut(s) 177
BmiI GGNNCC 5 cut(s) 87, 179, 230, 245, 254
BmrFI CCNGG 2 cut(s) 90, 250
BmtI GCTAGC 1 cut(s) 113
BsaJI CCNNGG 2 cut(s) 137, 248
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 95
Bse1I ACTGG 1 cut(s) 230
BseBI CCWGG 2 cut(s) 90, 250
BseDI CCNNGG 2 cut(s) 137, 248
BseGI GGATG 1 cut(s) 85
BseLI CCNNNNNNNGG 2 cut(s) 40, 95
BseMII CTCAG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 230
BseRI GAGGAG 1 cut(s) 98
BsgI GTGCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 178
BslI CCNNNNNNNGG 2 cut(s) 40, 95
BsnI GGCC 1 cut(s) 178
Bsp143I GATC 4 cut(s) 37, 228, 243, 252
BspACI CCGC 2 cut(s) 77, 181
BspANI GGCC 1 cut(s) 178
BspCNI CTCAG 1 cut(s) 176
BspLI GGNNCC 5 cut(s) 87, 179, 230, 245, 254
BspOI GCTAGC 1 cut(s) 113
BspPI GGATC 6 cut(s) 223, 236, 238, 247, 251, 260
BsrI ACTGG 1 cut(s) 230
BssECI CCNNGG 2 cut(s) 137, 248
BssMI GATC 4 cut(s) 37, 228, 243, 252
Bst2UI CCWGG 2 cut(s) 90, 250
Bst4CI ACNGT 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 163
BstDSI CCRYGG 1 cut(s) 137
BstENI CCTNNNNNAGG 1 cut(s) 93
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 4 cut(s) 40, 231, 246, 255
BstMBI GATC 4 cut(s) 37, 228, 243, 252
BstNI CCWGG 2 cut(s) 90, 250
BstSCI CCNGG 2 cut(s) 88, 248
BstX2I RGATCY 3 cut(s) 228, 243, 252
BstYI RGATCY 3 cut(s) 228, 243, 252
BsuRI GGCC 1 cut(s) 178
BtgI CCRYGG 1 cut(s) 137
BtsCI GGATG 1 cut(s) 85
Cac8I GCNNGC 1 cut(s) 111
Cfr13I GGNCC 1 cut(s) 177
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 7 cut(s) 88, 109, 113, 178, 218, 236, 260
CviKI_1 RGCY 7 cut(s) 88, 109, 113, 178, 218, 236, 260
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 163
DpnI GATC 4 cut(s) 39, 230, 245, 254
DpnII GATC 4 cut(s) 37, 228, 243, 252
EcoNI CCTNNNNNAGG 1 cut(s) 93
EcoRII CCWGG 2 cut(s) 88, 248
FauI CCCGC 1 cut(s) 188
FokI GGATG 1 cut(s) 92
FspBI CTAG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 178
HincII GTYRAC 1 cut(s) 10
HindII GTYRAC 1 cut(s) 10
HinfI GANTC 2 cut(s) 44, 102
HpaI GTTAAC 1 cut(s) 10
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 10
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 26
HpyF3I CTNAG 1 cut(s) 163
KspAI GTTAAC 1 cut(s) 10
Kzo9I GATC 4 cut(s) 37, 228, 243, 252
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 7 cut(s) 26, 33, 75, 102, 211, 235, 262
MaeI CTAG 1 cut(s) 110
MalI GATC 4 cut(s) 39, 230, 245, 254
MboI GATC 4 cut(s) 37, 228, 243, 252
MflI RGATCY 3 cut(s) 228, 243, 252
MluCI AATT 2 cut(s) 118, 265
MnlI CCTC 3 cut(s) 68, 76, 121
MseI TTAA 1 cut(s) 9
MspR9I CCNGG 2 cut(s) 90, 250
MvaI CCWGG 2 cut(s) 90, 250
NdeII GATC 4 cut(s) 37, 228, 243, 252
NheI GCTAGC 1 cut(s) 109
NlaIV GGNNCC 5 cut(s) 87, 179, 230, 245, 254
PfeI GAWTC 2 cut(s) 44, 102
Psp6I CCWGG 2 cut(s) 88, 248
PspGI CCWGG 2 cut(s) 88, 248
PspN4I GGNNCC 5 cut(s) 87, 179, 230, 245, 254
PspPI GGNCC 1 cut(s) 177
PsuI RGATCY 3 cut(s) 228, 243, 252
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 4 cut(s) 37, 228, 243, 252
Sau96I GGNCC 1 cut(s) 177
ScrFI CCNGG 2 cut(s) 90, 250
SetI ASST 5 cut(s) 60, 111, 220, 224, 238
Sse9I AATT 2 cut(s) 118, 265
SsiI CCGC 2 cut(s) 77, 181
SspMI CTAG 1 cut(s) 110
StyD4I CCNGG 2 cut(s) 88, 248
TaaI ACNGT 1 cut(s) 158
TaqI TCGA 1 cut(s) 214
TasI AATT 2 cut(s) 118, 265
TfiI GAWTC 2 cut(s) 44, 102
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 213
TspGWI ACGGA 1 cut(s) 126
XagI CCTNNNNNAGG 1 cut(s) 93
XapI RAATTY 1 cut(s) 118
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.