Rorug06G0157400
ERF Family

P-loop containing nucleoside triphosphate hydrolases superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0006980
Physical Location & Seq
Reverse (-)
22546414 .. 22547299
886 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0157400.1

Sequence Viewer

Length: 285 bp
ATGGGTTTTCGGTTACCAGCAATTGCTAGTGCCAAGAAAACTCTTACTAGATCTCTATCTGGTTCAAAGACATTAGATATCCCTAAAGGATACTTTGCCGTCTATGTTGGGGAGAGCCAGAAGAAACGATTCGTGGTTCCAATATCATACTTGAACCATCCTTCATTCCAAGATTTGTTGAGGCAAGCAGAAGAAGAATTTGGATTTGATCATCCCATGGGCGGTATCACCATCCCCTGCAGTGAGCACACCTTCCTTGATCTCACTTCAAGCTTAAGTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MMR_HSR1

Protein Analysis

94

Amino Acids

10.44

Weight (kDa)

6.83

Isoelectric Point (pI)

43.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 20 - 92 1.3e-25 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 222
AcsI RAATTY 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 221
AflII CTTAAG 1 cut(s) 274
AgsI TTSAA 3 cut(s) 66, 154, 270
AjuI GAANNNNNNNTTGG 2 cut(s) 183, 215
AluBI AGCT 1 cut(s) 273
AluI AGCT 1 cut(s) 273
Alw21I GWGCWC 1 cut(s) 249
ApoI RAATTY 1 cut(s) 197
Asp700I GAANNNNTTC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 220
Bbv12I GWGCWC 1 cut(s) 249
BccI CCATC 2 cut(s) 165, 239
BceAI ACGGC 1 cut(s) 83
BciVI GTATCC 1 cut(s) 83
BclI TGATCA 1 cut(s) 208
BfaI CTAG 2 cut(s) 27, 48
BfmI CTRYAG 1 cut(s) 238
BfrI CTTAAG 1 cut(s) 274
BfuI GTATCC 1 cut(s) 83
BglII AGATCT 1 cut(s) 50
BmiI GGNNCC 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 216
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse8I GATNNNNATC 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 216
BseGI GGATG 3 cut(s) 157, 211, 231
BseJI GATNNNNATC 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 221
BsiHKAI GWGCWC 1 cut(s) 249
BslI CCNNNNNNNGG 1 cut(s) 221
Bsp1286I GDGCHC 1 cut(s) 249
Bsp143I GATC 3 cut(s) 50, 208, 259
Bsp19I CCATGG 1 cut(s) 216
BspACI CCGC 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 138
BspMAI CTGCAG 1 cut(s) 242
BspTI CTTAAG 1 cut(s) 274
BssECI CCNNGG 1 cut(s) 216
BssMI GATC 3 cut(s) 50, 208, 259
BssT1I CCWWGG 1 cut(s) 216
BstAFI CTTAAG 1 cut(s) 274
BstC8I GCNNGC 1 cut(s) 186
BstDSI CCRYGG 1 cut(s) 216
BstEII GGTNACC 1 cut(s) 12
BstF5I GGATG 3 cut(s) 157, 211, 231
BstKTI GATC 3 cut(s) 53, 211, 262
BstMBI GATC 3 cut(s) 50, 208, 259
BstPI GGTNACC 1 cut(s) 12
BstSFI CTRYAG 1 cut(s) 238
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BsuI GTATCC 1 cut(s) 83
BtgI CCRYGG 1 cut(s) 216
BtsCI GGATG 3 cut(s) 157, 211, 231
BtsI GCAGTG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 247
Cac8I GCNNGC 1 cut(s) 186
CviAII CATG 1 cut(s) 217
CviJI RGCY 2 cut(s) 117, 273
CviKI_1 RGCY 2 cut(s) 117, 273
DpnI GATC 3 cut(s) 52, 210, 261
DpnII GATC 3 cut(s) 50, 208, 259
Eco130I CCWWGG 1 cut(s) 216
Eco32I GATATC 1 cut(s) 79
Eco91I GGTNACC 1 cut(s) 12
EcoO65I GGTNACC 1 cut(s) 12
EcoRV GATATC 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 216
FaeI CATG 1 cut(s) 220
FaiI YATR 3 cut(s) 105, 148, 218
FatI CATG 1 cut(s) 216
FbaI TGATCA 1 cut(s) 208
FokI GGATG 3 cut(s) 144, 198, 218
FspBI CTAG 2 cut(s) 27, 48
Hin1II CATG 1 cut(s) 220
HindIII AAGCTT 1 cut(s) 271
HinfI GANTC 1 cut(s) 129
HphI GGTGA 1 cut(s) 220
HpyAV CCTTC 2 cut(s) 171, 262
HpyCH4V TGCA 1 cut(s) 240
Hsp92II CATG 1 cut(s) 220
Ksp22I TGATCA 1 cut(s) 208
Kzo9I GATC 3 cut(s) 50, 208, 259
LpnPI CCDG 4 cut(s) 30, 45, 131, 250
MaeI CTAG 2 cut(s) 27, 48
MaeIII GTNAC 1 cut(s) 12
MalI GATC 3 cut(s) 52, 210, 261
MboI GATC 3 cut(s) 50, 208, 259
MboII GAAGA 3 cut(s) 133, 203, 206
MfeI CAATTG 1 cut(s) 21
MflI RGATCY 1 cut(s) 50
MhlI GDGCHC 1 cut(s) 249
MluCI AATT 2 cut(s) 21, 197
MnlI CCTC 1 cut(s) 174
MroXI GAANNNNTTC 1 cut(s) 128
MseI TTAA 1 cut(s) 275
MspCI CTTAAG 1 cut(s) 274
MunI CAATTG 1 cut(s) 21
NcoI CCATGG 1 cut(s) 216
NdeII GATC 3 cut(s) 50, 208, 259
NlaIII CATG 1 cut(s) 220
NlaIV GGNNCC 1 cut(s) 138
PdmI GAANNNNTTC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 129
PspEI GGTNACC 1 cut(s) 12
PspN4I GGNNCC 1 cut(s) 138
PstI CTGCAG 1 cut(s) 242
PsuI RGATCY 1 cut(s) 50
SaqAI TTAA 1 cut(s) 275
Sau3AI GATC 3 cut(s) 50, 208, 259
SduI GDGCHC 1 cut(s) 249
SetI ASST 2 cut(s) 254, 275
SfcI CTRYAG 1 cut(s) 238
SmlI CTYRAG 1 cut(s) 274
SmoI CTYRAG 1 cut(s) 274
Sse9I AATT 2 cut(s) 21, 197
SsiI CCGC 1 cut(s) 222
SspMI CTAG 2 cut(s) 27, 48
StyI CCWWGG 1 cut(s) 216
TasI AATT 2 cut(s) 21, 197
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 1 cut(s) 275
Tru9I TTAA 1 cut(s) 275
TscAI CASTG 1 cut(s) 247
TspDTI ATGAA 1 cut(s) 153
TspRI CASTG 1 cut(s) 247
Vha464I CTTAAG 1 cut(s) 274
XapI RAATTY 1 cut(s) 197
XmnI GAANNNNTTC 1 cut(s) 128
XspI CTAG 2 cut(s) 27, 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.