Rorug06G0228300

KIP1-like protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
36678613 .. 36679545
933 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0228300.1

Sequence Viewer

Length: 210 bp
ATGAGGGGAGCTTGTTCTAGGAAGAGAAACCATCAAGATGATGAAGATAATTTTCCTAGAGGGATTTCCAGAAGATATTCCAAAAGTGGGTGTTCAAAGTGCTTGGCAACCTCCTTCTCTCGACTTGCTATAGATATTCAACATGAAAAAGGGCAATGCCCATCCCTCATGGACTTCTACGTACGGCAAATACGTGAGTTCAGAGAATGA

Protein Analysis

69

Amino Acids

8.11

Weight (kDa)

9.38

Isoelectric Point (pI)

49.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 183
AfiI CCNNNNNNNGG 1 cut(s) 87
AgsI TTSAA 2 cut(s) 96, 140
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
Asp700I GAANNNNTTC 1 cut(s) 76
BccI CCATC 2 cut(s) 39, 169
BceAI ACGGC 1 cut(s) 200
BfaI CTAG 2 cut(s) 18, 57
BfmI CTRYAG 1 cut(s) 129
BsaAI YACGTR 2 cut(s) 181, 194
Bsc4I CCNNNNNNNGG 1 cut(s) 87
Bse3DI GCAATG 1 cut(s) 161
BseGI GGATG 1 cut(s) 161
BseLI CCNNNNNNNGG 1 cut(s) 87
BseMI GCAATG 1 cut(s) 161
BsiWI CGTACG 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 87
BsrDI GCAATG 1 cut(s) 161
Bst6I CTCTTC 1 cut(s) 17
BstBAI YACGTR 2 cut(s) 181, 194
BstF5I GGATG 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 129
BstSNI TACGTA 1 cut(s) 181
BtsCI GGATG 1 cut(s) 161
Csp6I GTAC 1 cut(s) 182
CviAII CATG 2 cut(s) 143, 169
CviJI RGCY 1 cut(s) 11
CviKI_1 RGCY 1 cut(s) 11
CviQI GTAC 1 cut(s) 182
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
Eco105I TACGTA 1 cut(s) 181
FaeI CATG 2 cut(s) 146, 172
FaiI YATR 3 cut(s) 131, 144, 170
FatI CATG 2 cut(s) 142, 168
FokI GGATG 1 cut(s) 148
FspBI CTAG 2 cut(s) 18, 57
Hin1II CATG 2 cut(s) 146, 172
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 3 cut(s) 35, 69, 120
HpyAV CCTTC 1 cut(s) 124
HpyCH4IV ACGT 2 cut(s) 180, 193
HpySE526I ACGT 2 cut(s) 180, 193
Hsp92II CATG 2 cut(s) 146, 172
LmnI GCTCC 1 cut(s) 8
LpnPI CCDG 1 cut(s) 82
MaeI CTAG 2 cut(s) 18, 57
MaeII ACGT 2 cut(s) 180, 193
MboII GAAGA 3 cut(s) 34, 56, 84
MluCI AATT 1 cut(s) 49
MnlI CCTC 3 cut(s) 53, 121, 176
MroXI GAANNNNTTC 1 cut(s) 76
MslI CAYNNNNRTG 1 cut(s) 36
NlaIII CATG 2 cut(s) 146, 172
PcsI WCGNNNNNNNCGW 1 cut(s) 190
PdmI GAANNNNTTC 1 cut(s) 76
Pfl23II CGTACG 1 cut(s) 181
Ppu21I YACGTR 2 cut(s) 181, 194
PspLI CGTACG 1 cut(s) 181
RsaI GTAC 1 cut(s) 183
RsaNI GTAC 1 cut(s) 182
RseI CAYNNNNRTG 1 cut(s) 36
SetI ASST 4 cut(s) 13, 113, 183, 196
SfcI CTRYAG 1 cut(s) 129
SmiMI CAYNNNNRTG 1 cut(s) 36
SnaBI TACGTA 1 cut(s) 181
Sse9I AATT 1 cut(s) 49
SspMI CTAG 2 cut(s) 18, 57
TaiI ACGT 2 cut(s) 183, 196
TaqI TCGA 1 cut(s) 121
TasI AATT 1 cut(s) 49
TspDTI ATGAA 2 cut(s) 57, 159
XmnI GAANNNNTTC 1 cut(s) 76
XspI CTAG 2 cut(s) 18, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.