Rorug06G0362200

Coenzyme Q-binding protein COQ10 homolog

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
51039810 .. 51040034
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0362200.1

Sequence Viewer

Length: 225 bp
ATGGCTAGAACGAAGGTGAAACTACAATACATTGTCAATAAGAGTTCCCGAAGAAACACATTTAGAAAAAGGAAGGAGGGCCTTCTGAAGAAGGTGTACGAGATCACCACTCTCTATGACATCAAGGCTGCGGCGATCATCTACAATCCCTTTGACGCAGAGCCGGAGGTCTTCCTAAGTCATCCGGAAGTCCACGAAATGCTGATAAGGTTCCAAGATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.83

Weight (kDa)

9.69

Isoelectric Point (pI)

47.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRF-TF PF00319 10 - 50 1.1e-13 SRF-type transcription factor (DNA-binding and dimerisation domain)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011040)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 184
AciI CCGC 1 cut(s) 131
AcuI CTGAAG 1 cut(s) 107
AfaI GTAC 1 cut(s) 98
Aor13HI TCCGGA 1 cut(s) 184
AoxI GGCC 1 cut(s) 79
ApeKI GCWGC 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 79
AsuHPI GGTGA 2 cut(s) 28, 97
BarI GAAGNNNNNNTAC 2 cut(s) 80, 112
BbsI GAAGAC 1 cut(s) 163
BbvI GCAGC 1 cut(s) 115
BfaI CTAG 1 cut(s) 6
BisI GCNGC 2 cut(s) 129, 132
BlsI GCNGC 2 cut(s) 130, 133
BmgT120I GGNCC 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 212
BpiI GAAGAC 1 cut(s) 163
BsaWI WCCGGW 1 cut(s) 184
BseAI TCCGGA 1 cut(s) 184
BseGI GGATG 1 cut(s) 181
BseXI GCAGC 1 cut(s) 115
BshFI GGCC 1 cut(s) 81
BsiSI CCGG 2 cut(s) 164, 185
BsnI GGCC 1 cut(s) 81
Bsp13I TCCGGA 1 cut(s) 184
Bsp143I GATC 2 cut(s) 102, 135
BspACI CCGC 1 cut(s) 131
BspANI GGCC 1 cut(s) 81
BspEI TCCGGA 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 212
BssMI GATC 2 cut(s) 102, 135
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 2 cut(s) 105, 138
BstMBI GATC 2 cut(s) 102, 135
BstV1I GCAGC 1 cut(s) 115
BstV2I GAAGAC 1 cut(s) 163
BsuRI GGCC 1 cut(s) 81
BtsCI GGATG 1 cut(s) 181
Cfr13I GGNCC 1 cut(s) 79
CseI GACGC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 97
CviJI RGCY 4 cut(s) 5, 81, 128, 163
CviKI_1 RGCY 4 cut(s) 5, 81, 128, 163
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 1 cut(s) 176
DpnI GATC 2 cut(s) 104, 137
DpnII GATC 2 cut(s) 102, 135
Eco57I CTGAAG 1 cut(s) 107
EcoO109I RGGNCCY 1 cut(s) 79
FaiI YATR 2 cut(s) 117, 221
Fnu4HI GCNGC 2 cut(s) 129, 132
FokI GGATG 1 cut(s) 168
Fsp4HI GCNGC 2 cut(s) 129, 132
FspBI CTAG 1 cut(s) 6
GluI GCNGC 2 cut(s) 129, 132
HaeIII GGCC 1 cut(s) 81
HapII CCGG 2 cut(s) 164, 185
HgaI GACGC 1 cut(s) 164
HpaII CCGG 2 cut(s) 164, 185
HphI GGTGA 2 cut(s) 28, 97
Hpy166II GTNNAC 2 cut(s) 97, 193
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 2 cut(s) 48, 185
Hpy8I GTNNAC 2 cut(s) 97, 193
HpyAV CCTTC 4 cut(s) 7, 67, 85, 92
HpyF3I CTNAG 1 cut(s) 176
Kpn2I TCCGGA 1 cut(s) 184
Kzo9I GATC 2 cut(s) 102, 135
LpnPI CCDG 2 cut(s) 177, 198
Lsp1109I GCAGC 1 cut(s) 115
MaeI CTAG 1 cut(s) 6
MalI GATC 2 cut(s) 104, 137
MboI GATC 2 cut(s) 102, 135
MboII GAAGA 3 cut(s) 63, 100, 163
MnlI CCTC 2 cut(s) 70, 160
MroI TCCGGA 1 cut(s) 184
MspI CCGG 2 cut(s) 164, 185
NdeII GATC 2 cut(s) 102, 135
NlaIV GGNNCC 1 cut(s) 212
PkrI GCNGC 2 cut(s) 130, 133
PspN4I GGNNCC 1 cut(s) 212
PspPI GGNCC 1 cut(s) 79
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SatI GCNGC 2 cut(s) 129, 132
Sau3AI GATC 2 cut(s) 102, 135
Sau96I GGNCC 1 cut(s) 79
SetI ASST 4 cut(s) 18, 96, 171, 212
SgeI CNNG 7 cut(s) 18, 60, 112, 136, 176, 197, 206
SsiI CCGC 1 cut(s) 131
SspMI CTAG 1 cut(s) 6
TauI GCSGC 1 cut(s) 134
TseI GCWGC 1 cut(s) 128
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.