Rorug07G0119700

Endoplasmic reticulum-based factor for assembly of V-ATPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0003225
Physical Location & Seq
Forward (+)
9372176 .. 9373837
1662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0119700.1

Sequence Viewer

Length: 600 bp
ATGATTTATAGTTACTTTAGATTTCTGAAATATAATCCTTATGCTGTGTATAAATCATTTTACGCTACCATTAAGGTTCCAAATTCCAGAAATTCACTCCAAGGTTACAAGAAGCTCCAAGCTGTTCCGAGAGCTATTATGCTGCGCCGAACAGAAGGAAAAATGATTGATGGGCAACCTATAATTAATTTACCACCAAAAACAATTAACCTGAGTAAAGTGGAGTTCCCGTCTGAGGAGAGGGCCTTCTATACCAAATTAGAAGCTGATTCACGCTCTCAATTCAAGGCATATGCTGCTGCTGGTACAGAAAATCAAAACTATGCAAATATCCTTTTGATGCTTTTGCACCATCGGCAGGCTTGTGATCACCCACTGCTTGTTAAAGGATATGACTCTGACTGCGTTGGGAAAGATTCTGTGGCTATGGCAAGTACACTTTCTAGGGAGATGCTTATCAATCTATTGAATGCCCTGGAAAGTTCCGAGGCCATTTGTCGTGTATGCAATGTGAGCTTTCTTGAAACTTTTCCTTACTGGATATTACTACTTAAACTAGAGATAGATGCAAATGAATTGATTTCAGTAAAAAGTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Vma12

Protein Analysis

199

Amino Acids

22.7

Weight (kDa)

8.95

Isoelectric Point (pI)

52.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNF2-rel_dom PF00176 3 - 125 1.2e-11 SNF2-related domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 82, 91
AfaI GTAC 2 cut(s) 307, 436
AfiI CCNNNNNNNGG 2 cut(s) 235, 358
AgsI TTSAA 3 cut(s) 286, 469, 524
AjnI CCWGG 1 cut(s) 474
AluBI AGCT 5 cut(s) 115, 122, 134, 266, 516
AluI AGCT 5 cut(s) 115, 122, 134, 266, 516
AoxI GGCC 2 cut(s) 243, 489
ApeKI GCWGC 3 cut(s) 142, 296, 299
ApoI RAATTY 2 cut(s) 82, 91
AseI ATTAAT 1 cut(s) 186
Asp700I GAANNNNTTC 1 cut(s) 528
AspLEI GCGC 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 243
AsuHPI GGTGA 1 cut(s) 362
BbvI GCAGC 3 cut(s) 129, 283, 286
BccI CCATC 2 cut(s) 164, 360
BciT130I CCWGG 1 cut(s) 476
BclI TGATCA 1 cut(s) 367
BfaI CTAG 2 cut(s) 444, 557
BisI GCNGC 3 cut(s) 143, 297, 300
BlsI GCNGC 3 cut(s) 144, 298, 301
Bme1390I CCNGG 1 cut(s) 476
BmgT120I GGNCC 1 cut(s) 243
BmiI GGNNCC 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 476
BmsI GCATC 3 cut(s) 330, 441, 556
BsaBI GATNNNNATC 1 cut(s) 455
BsaJI CCNNGG 3 cut(s) 100, 474, 486
BsaXI ACNNNNNCTCC 2 cut(s) 215, 245
Bsc4I CCNNNNNNNGG 2 cut(s) 235, 358
Bse1I ACTGG 1 cut(s) 542
Bse3DI GCAATG 1 cut(s) 514
Bse8I GATNNNNATC 1 cut(s) 455
BseBI CCWGG 1 cut(s) 476
BseDI CCNNGG 3 cut(s) 100, 474, 486
BseJI GATNNNNATC 1 cut(s) 455
BseLI CCNNNNNNNGG 2 cut(s) 235, 358
BseMI GCAATG 1 cut(s) 514
BseMII CTCAG 2 cut(s) 203, 225
BseNI ACTGG 1 cut(s) 542
BseRI GAGGAG 1 cut(s) 251
BseXI GCAGC 3 cut(s) 129, 283, 286
BshFI GGCC 2 cut(s) 245, 491
BslI CCNNNNNNNGG 2 cut(s) 235, 358
BsmI GAATGC 1 cut(s) 475
BsnI GGCC 2 cut(s) 245, 491
Bsp143I GATC 1 cut(s) 367
BspANI GGCC 2 cut(s) 245, 491
BspCNI CTCAG 2 cut(s) 204, 226
BspLI GGNNCC 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 514
BsrI ACTGG 1 cut(s) 542
BssECI CCNNGG 3 cut(s) 100, 474, 486
BssMI GATC 1 cut(s) 367
BssT1I CCWWGG 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 476
BstAPI GCANNNNNTGC 1 cut(s) 296
BstC8I GCNNGC 1 cut(s) 360
BstDEI CTNAG 2 cut(s) 212, 234
BstHHI GCGC 1 cut(s) 147
BstKTI GATC 1 cut(s) 370
BstMBI GATC 1 cut(s) 367
BstMWI GCNNNNNNNGC 3 cut(s) 296, 355, 513
BstNI CCWGG 1 cut(s) 476
BstSCI CCNGG 1 cut(s) 474
BstV1I GCAGC 3 cut(s) 129, 283, 286
BsuRI GGCC 2 cut(s) 245, 491
BtsI GCAGTG 1 cut(s) 374
BtsIMutI CAGTG 1 cut(s) 374
Cac8I GCNNGC 1 cut(s) 360
CfoI GCGC 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 243
Csp6I GTAC 2 cut(s) 306, 435
CviJI RGCY 9 cut(s) 115, 122, 134, 245, 266, 362, 425, 491, 516
CviKI_1 RGCY 9 cut(s) 115, 122, 134, 245, 266, 362, 425, 491, 516
CviQI GTAC 2 cut(s) 306, 435
DdeI CTNAG 2 cut(s) 212, 234
DpnI GATC 1 cut(s) 369
DpnII GATC 1 cut(s) 367
Eco130I CCWWGG 1 cut(s) 100
EcoO109I RGGNCCY 1 cut(s) 243
EcoRII CCWGG 1 cut(s) 474
EcoT14I CCWWGG 1 cut(s) 100
ErhI CCWWGG 1 cut(s) 100
FauNDI CATATG 1 cut(s) 292
FbaI TGATCA 1 cut(s) 367
Fnu4HI GCNGC 3 cut(s) 143, 297, 300
Fsp4HI GCNGC 3 cut(s) 143, 297, 300
FspBI CTAG 2 cut(s) 444, 557
GlaI GCGC 1 cut(s) 146
GluI GCNGC 3 cut(s) 143, 297, 300
HaeIII GGCC 2 cut(s) 245, 491
HhaI GCGC 1 cut(s) 147
Hin6I GCGC 1 cut(s) 145
HinP1I GCGC 1 cut(s) 145
HinfI GANTC 3 cut(s) 269, 395, 416
HphI GGTGA 1 cut(s) 362
Hpy166II GTNNAC 1 cut(s) 437
Hpy188I TCNGA 5 cut(s) 27, 129, 235, 400, 487
Hpy188III TCNNGA 2 cut(s) 87, 521
Hpy8I GTNNAC 1 cut(s) 437
HpyAV CCTTC 2 cut(s) 149, 256
HpyCH4V TGCA 4 cut(s) 326, 349, 507, 569
HpyF10VI GCNNNNNNNGC 3 cut(s) 296, 355, 513
HpyF3I CTNAG 2 cut(s) 212, 234
HspAI GCGC 1 cut(s) 145
Ksp22I TGATCA 1 cut(s) 367
Kzo9I GATC 1 cut(s) 367
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 7 cut(s) 100, 224, 288, 344, 461, 488, 523
Lsp1109I GCAGC 3 cut(s) 129, 283, 286
LweI GCATC 3 cut(s) 330, 441, 556
MaeI CTAG 2 cut(s) 444, 557
MaeIII GTNAC 2 cut(s) 11, 104
MalI GATC 1 cut(s) 369
MboI GATC 1 cut(s) 367
MluCI AATT 8 cut(s) 82, 91, 183, 187, 204, 257, 281, 575
MlyI GAGTC 1 cut(s) 389
MnlI CCTC 3 cut(s) 229, 234, 481
MroXI GAANNNNTTC 1 cut(s) 528
MseI TTAA 5 cut(s) 72, 186, 207, 384, 552
MspR9I CCNGG 1 cut(s) 476
Mva1269I GAATGC 1 cut(s) 475
MvaI CCWGG 1 cut(s) 476
MwoI GCNNNNNNNGC 3 cut(s) 296, 355, 513
NdeI CATATG 1 cut(s) 292
NdeII GATC 1 cut(s) 367
NlaIV GGNNCC 1 cut(s) 78
PctI GAATGC 1 cut(s) 475
PdmI GAANNNNTTC 1 cut(s) 528
PfeI GAWTC 2 cut(s) 269, 416
PkrI GCNGC 3 cut(s) 144, 298, 301
PleI GAGTC 1 cut(s) 389
PpsI GAGTC 1 cut(s) 389
PshBI ATTAAT 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 474
PspGI CCWGG 1 cut(s) 474
PspN4I GGNNCC 1 cut(s) 78
PspPI GGNCC 1 cut(s) 243
RsaI GTAC 2 cut(s) 307, 436
RsaNI GTAC 2 cut(s) 306, 435
SaqAI TTAA 5 cut(s) 72, 186, 207, 384, 552
SatI GCNGC 3 cut(s) 143, 297, 300
Sau3AI GATC 1 cut(s) 367
Sau96I GGNCC 1 cut(s) 243
SchI GAGTC 1 cut(s) 389
ScrFI CCNGG 1 cut(s) 476
SetI ASST 9 cut(s) 78, 106, 117, 124, 136, 181, 213, 268, 518
SfaNI GCATC 3 cut(s) 330, 441, 556
Sse9I AATT 8 cut(s) 82, 91, 183, 187, 204, 257, 281, 575
SspMI CTAG 2 cut(s) 444, 557
StyD4I CCNGG 1 cut(s) 474
StyI CCWWGG 1 cut(s) 100
TasI AATT 8 cut(s) 82, 91, 183, 187, 204, 257, 281, 575
TatI WGTACW 1 cut(s) 434
TfiI GAWTC 2 cut(s) 269, 416
Tru1I TTAA 5 cut(s) 72, 186, 207, 384, 552
Tru9I TTAA 5 cut(s) 72, 186, 207, 384, 552
TscAI CASTG 1 cut(s) 381
TseI GCWGC 3 cut(s) 142, 296, 299
TspDTI ATGAA 1 cut(s) 588
TspRI CASTG 1 cut(s) 381
VspI ATTAAT 1 cut(s) 186
XapI RAATTY 2 cut(s) 82, 91
XmnI GAANNNNTTC 1 cut(s) 528
XspI CTAG 2 cut(s) 444, 557
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.