Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000007

Orthogroup ID

OG0006933

Physical Location & Seq

Genomic Coordinates Forward (+)

11215890 .. 11224141

Gene Structure 8252 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug07G0142100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

ATGCGTTGCACACAAGAACTTCATGAGGTCTTTGTTGAAGCTGTCAACCAGCTTGGTGGTGGTGAAAGAGTCACTCCTAAGGGTATCTTAAACGTCATGATGGTTGAAGGCTTCACAATGTATCATGTAAAAAGCCATTTACAGGTTCATTCTTCTCATGTGTTCAGTCATCCACCAATAACTTTTTCTTGGCCTGAAGACCTTGAACTTGCTCTTGAAGCCAAGAAGTTACAAGTTCAACATGGGAATAGCACTGTGAATGCCTTTTCAAGTTTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03030 ko03420 ko03430 ko03440 ko03460 map03030 map03420 map03430 map03440 map03460

Pfam Domains

Protein Families

REPA_OB_2 Rep-A_N Rep_fac-A_C tRNA_anti-codon zf-CCHC

Protein Analysis

92

Amino Acids

10.35

Weight (kDa)

6.12

Isoelectric Point (pI)

31.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006933)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g23980 FvH4_5g23980
malus_domestica	MD00G1002000.v1.1 MD06G1015600.v1.1
prunus_persica	Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1 Prupe.5G020000_v2.0.a1
pyrus_communis	pycom06g01260 pycom16g25500
rosa_chinensis	RchiOBHm_Chr7g0213421
rosa_laevigata	RLG00000002805
rosa_multiflora	Rmu_sc0003740.1_g000017 Rmu_sc0013012.1_g000001
rosa_roxburghii	Rroxscaffold_3G00245920
rosa_rugosa	Rorug07G0142100 Rorug07G0142200
rosa_samantha	Rh7AG274100 Rh7BG269400 Rh7CG293200 Rh7DG281600
rosa_wichuraiana	Rw7G023770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	216
AfiI	CCNNNNNNNGG	1 cut(s)	142
AgsI	TTSAA	6 cut(s)	38, 107, 206, 218, 239, 270
AjuI	GAANNNNNNNTTGG	2 cut(s)	169, 201
AluBI	AGCT	2 cut(s)	41, 52
AluI	AGCT	2 cut(s)	41, 52
AoxI	GGCC	1 cut(s)	191
AsuHPI	GGTGA	1 cut(s)	74
AxyI	CCTNAGG	1 cut(s)	78
BbsI	GAAGAC	1 cut(s)	204
BccI	CCATC	1 cut(s)	94
BfaI	CTAG	1 cut(s)	277
BpiI	GAAGAC	1 cut(s)	204
Bsc4I	CCNNNNNNNGG	1 cut(s)	142
Bse21I	CCTNAGG	1 cut(s)	78
BseGI	GGATG	1 cut(s)	169
BseLI	CCNNNNNNNGG	1 cut(s)	142
BshFI	GGCC	1 cut(s)	193
BslI	CCNNNNNNNGG	1 cut(s)	142
BsmI	GAATGC	1 cut(s)	265
BsnI	GGCC	1 cut(s)	193
BspANI	GGCC	1 cut(s)	193
BspHI	TCATGA	2 cut(s)	22, 96
Bst4CI	ACNGT	1 cut(s)	256
BstDEI	CTNAG	1 cut(s)	78
BstF5I	GGATG	1 cut(s)	169
BstMWI	GCNNNNNNNGC	1 cut(s)	218
BstV2I	GAAGAC	1 cut(s)	204
BstXI	CCANNNNNNTGG	1 cut(s)	56
Bsu36I	CCTNAGG	1 cut(s)	78
BsuRI	GGCC	1 cut(s)	193
BtsCI	GGATG	1 cut(s)	169
BtsIMutI	CAGTG	1 cut(s)	252
CciI	TCATGA	2 cut(s)	22, 96
CviAII	CATG	5 cut(s)	23, 97, 125, 158, 242
CviJI	RGCY	6 cut(s)	41, 52, 111, 135, 193, 221
CviKI_1	RGCY	6 cut(s)	41, 52, 111, 135, 193, 221
DdeI	CTNAG	1 cut(s)	78
Eco57I	CTGAAG	1 cut(s)	216
Eco81I	CCTNAGG	1 cut(s)	78
FaeI	CATG	5 cut(s)	26, 100, 128, 161, 245
FaiI	YATR	5 cut(s)	24, 98, 126, 159, 243
FalI	AAGNNNNNCTT	2 cut(s)	71, 103
FatI	CATG	5 cut(s)	22, 96, 124, 157, 241
FokI	GGATG	1 cut(s)	156
FspBI	CTAG	1 cut(s)	277
HaeIII	GGCC	1 cut(s)	193
Hin1II	CATG	5 cut(s)	26, 100, 128, 161, 245
HincII	GTYRAC	1 cut(s)	46
HindII	GTYRAC	1 cut(s)	46
HinfI	GANTC	1 cut(s)	69
HphI	GGTGA	1 cut(s)	74
Hpy166II	GTNNAC	1 cut(s)	46
Hpy188III	TCNNGA	3 cut(s)	23, 97, 215
Hpy8I	GTNNAC	1 cut(s)	46
HpyAV	CCTTC	1 cut(s)	101
HpyCH4III	ACNGT	1 cut(s)	256
HpyCH4IV	ACGT	1 cut(s)	93
HpyCH4V	TGCA	1 cut(s)	9
HpyF10VI	GCNNNNNNNGC	1 cut(s)	218
HpyF3I	CTNAG	1 cut(s)	78
HpySE526I	ACGT	1 cut(s)	93
Hsp92II	CATG	5 cut(s)	26, 100, 128, 161, 245
LpnPI	CCDG	3 cut(s)	62, 128, 207
MaeI	CTAG	1 cut(s)	277
MaeII	ACGT	1 cut(s)	93
MaeIII	GTNAC	2 cut(s)	70, 228
MboII	GAAGA	2 cut(s)	144, 209
MlyI	GAGTC	1 cut(s)	78
MnlI	CCTC	1 cut(s)	19
MseI	TTAA	1 cut(s)	89
Mva1269I	GAATGC	1 cut(s)	265
MwoI	GCNNNNNNNGC	1 cut(s)	218
NlaIII	CATG	5 cut(s)	26, 100, 128, 161, 245
NmuCI	GTSAC	1 cut(s)	70
PagI	TCATGA	2 cut(s)	22, 96
PctI	GAATGC	1 cut(s)	265
PleI	GAGTC	1 cut(s)	77
PpsI	GAGTC	1 cut(s)	77
SaqAI	TTAA	1 cut(s)	89
SchI	GAGTC	1 cut(s)	78
SetI	ASST	6 cut(s)	30, 43, 54, 96, 147, 204
SspMI	CTAG	1 cut(s)	277
TaaI	ACNGT	1 cut(s)	256
TaiI	ACGT	1 cut(s)	96
Tru1I	TTAA	1 cut(s)	89
Tru9I	TTAA	1 cut(s)	89
TscAI	CASTG	1 cut(s)	259
TseFI	GTSAC	1 cut(s)	70
Tsp45I	GTSAC	1 cut(s)	70
TspDTI	ATGAA	2 cut(s)	11, 137
TspRI	CASTG	1 cut(s)	259
XcmI	CCANNNNNNNNNTGG	1 cut(s)	56
XspI	CTAG	1 cut(s)	277

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.