Rorug07G0300900

Universal stress protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0010262
Physical Location & Seq
Forward (+)
29860010 .. 29873775
13766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0300900.1

Sequence Viewer

Length: 498 bp
ATGTCAACTTTAGAAGTACAAGGTCATAGGGAGAAAGCACTGAACCATGGAACAGATGAATGCTTGATCAACACAATTGAGGCCTGCACCATCACCATCTATCCTAATGTGAATCGGCATTTTACATTCATCCACTGCGTTGAGAGGCTCACGTTGCAGAACAAACACAGTAAATGGGCCGATTGCTTTGAAATGTCGAACTTGGGGACTGTACCTATCGATTGCTACAACAGTGGATATGGCAATCAGATTGAAACAAAATATGCAAAGGAAACTGCTCAGCTTAATCCACCACATAGATTTGTGCCGTGGCTGGTTGTCAATAATAAACCACTTGCAGAGGACTACGGAAATTTTATGGCCTATATCTGTAAGGCATACAAAGGAAAAACTCCAGAAGCTTGCAGATCCATTCGCTACAAGACTGAATCAATTGGAAATGAAAAATCGATTCCTCAAGTTTGCCTAGCAGAACAACGAAGAAACTCTACATCTTAA

Protein Analysis

165

Amino Acids

18.85

Weight (kDa)

8.1

Isoelectric Point (pI)

49.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GILT PF03227 15 - 64 6.7e-11 Gamma interferon inducible lysosomal thiol reductase (GILT)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 402
AcsI RAATTY 1 cut(s) 352
AfaI GTAC 2 cut(s) 18, 213
AgsI TTSAA 2 cut(s) 191, 254
AluBI AGCT 2 cut(s) 283, 401
AluI AGCT 2 cut(s) 283, 401
AlwI GGATC 1 cut(s) 402
AoxI GGCC 3 cut(s) 81, 177, 360
ApoI RAATTY 1 cut(s) 352
AspS9I GGNCC 1 cut(s) 177
AsuHPI GGTGA 1 cut(s) 85
BarI GAAGNNNNNNTAC 1 cut(s) 472
BccI CCATC 2 cut(s) 98, 104
BceAI ACGGC 1 cut(s) 292
BclI TGATCA 1 cut(s) 66
BfaI CTAG 1 cut(s) 467
BlpI GCTNAGC 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 177
BpmI CTGGAG 1 cut(s) 378
Bpu1102I GCTNAGC 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 441
Bsa29I ATCGAT 2 cut(s) 219, 449
BsaJI CCNNGG 2 cut(s) 46, 308
BseCI ATCGAT 2 cut(s) 219, 449
BseDI CCNNGG 2 cut(s) 46, 308
BseGI GGATG 1 cut(s) 129
BseMII CTCAG 1 cut(s) 293
BsgI GTGCAG 1 cut(s) 70
BshFI GGCC 3 cut(s) 83, 179, 362
BshVI ATCGAT 2 cut(s) 219, 449
BslFI GGGAC 1 cut(s) 220
BsmFI GGGAC 1 cut(s) 220
BsmI GAATGC 1 cut(s) 65
BsnI GGCC 3 cut(s) 83, 179, 362
Bsp143I GATC 2 cut(s) 66, 407
Bsp1720I GCTNAGC 1 cut(s) 279
Bsp19I CCATGG 1 cut(s) 46
BspANI GGCC 3 cut(s) 83, 179, 362
BspCNI CTCAG 1 cut(s) 292
BspDI ATCGAT 2 cut(s) 219, 449
BspPI GGATC 1 cut(s) 402
BssECI CCNNGG 2 cut(s) 46, 308
BssMI GATC 2 cut(s) 66, 407
BssT1I CCWWGG 1 cut(s) 46
Bst4CI ACNGT 3 cut(s) 170, 211, 233
BstC8I GCNNGC 2 cut(s) 85, 403
BstDEI CTNAG 1 cut(s) 279
BstDSI CCRYGG 2 cut(s) 46, 308
BstF5I GGATG 1 cut(s) 129
BstKTI GATC 2 cut(s) 69, 410
BstMBI GATC 2 cut(s) 66, 407
BstMWI GCNNNNNNNGC 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 407
BstYI RGATCY 1 cut(s) 407
Bsu15I ATCGAT 2 cut(s) 219, 449
BsuRI GGCC 3 cut(s) 83, 179, 362
BsuTUI ATCGAT 2 cut(s) 219, 449
BtgI CCRYGG 2 cut(s) 46, 308
BtsCI GGATG 1 cut(s) 129
BtsI GCAGTG 1 cut(s) 133
BtsIMutI CAGTG 3 cut(s) 38, 133, 238
Cac8I GCNNGC 2 cut(s) 85, 403
Cfr13I GGNCC 1 cut(s) 177
ClaI ATCGAT 2 cut(s) 219, 449
Csp6I GTAC 2 cut(s) 17, 212
CviAII CATG 1 cut(s) 47
CviJI RGCY 7 cut(s) 83, 148, 179, 283, 313, 362, 401
CviKI_1 RGCY 7 cut(s) 83, 148, 179, 283, 313, 362, 401
CviQI GTAC 2 cut(s) 17, 212
DdeI CTNAG 1 cut(s) 279
DpnI GATC 2 cut(s) 68, 409
DpnII GATC 2 cut(s) 66, 407
Eco130I CCWWGG 1 cut(s) 46
Eco147I AGGCCT 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 46
ErhI CCWWGG 1 cut(s) 46
FaeI CATG 1 cut(s) 50
FaiI YATR 8 cut(s) 27, 48, 240, 264, 297, 359, 366, 379
FaqI GGGAC 1 cut(s) 220
FatI CATG 1 cut(s) 46
FbaI TGATCA 1 cut(s) 66
FokI GGATG 1 cut(s) 116
FspBI CTAG 1 cut(s) 467
GsuI CTGGAG 1 cut(s) 378
HaeIII GGCC 3 cut(s) 83, 179, 362
Hin1II CATG 1 cut(s) 50
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 399
HinfI GANTC 3 cut(s) 112, 428, 451
HphI GGTGA 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 249
Hpy188III TCNNGA 1 cut(s) 395
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 3 cut(s) 170, 211, 233
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 5 cut(s) 87, 157, 266, 338, 405
HpyF10VI GCNNNNNNNGC 1 cut(s) 154
HpyF3I CTNAG 1 cut(s) 279
HpySE526I ACGT 1 cut(s) 152
Hsp92II CATG 1 cut(s) 50
Ksp22I TGATCA 1 cut(s) 66
Kzo9I GATC 2 cut(s) 66, 407
LpnPI CCDG 3 cut(s) 97, 299, 408
MaeI CTAG 1 cut(s) 467
MaeII ACGT 1 cut(s) 152
MalI GATC 2 cut(s) 68, 409
MboI GATC 2 cut(s) 66, 407
MboII GAAGA 1 cut(s) 492
MfeI CAATTG 2 cut(s) 75, 432
MflI RGATCY 1 cut(s) 407
MluCI AATT 3 cut(s) 75, 352, 432
MnlI CCTC 4 cut(s) 73, 138, 334, 465
MseI TTAA 2 cut(s) 285, 496
MunI CAATTG 2 cut(s) 75, 432
Mva1269I GAATGC 1 cut(s) 65
MwoI GCNNNNNNNGC 1 cut(s) 154
NcoI CCATGG 1 cut(s) 46
NdeII GATC 2 cut(s) 66, 407
NlaIII CATG 1 cut(s) 50
PceI AGGCCT 1 cut(s) 83
PctI GAATGC 1 cut(s) 65
PfeI GAWTC 3 cut(s) 112, 428, 451
PspPI GGNCC 1 cut(s) 177
PsuI RGATCY 1 cut(s) 407
RsaI GTAC 2 cut(s) 18, 213
RsaNI GTAC 2 cut(s) 17, 212
SaqAI TTAA 2 cut(s) 285, 496
Sau3AI GATC 2 cut(s) 66, 407
Sau96I GGNCC 1 cut(s) 177
SetI ASST 5 cut(s) 25, 155, 217, 285, 403
SmlI CTYRAG 1 cut(s) 456
SmoI CTYRAG 1 cut(s) 456
Sse9I AATT 3 cut(s) 75, 352, 432
SseBI AGGCCT 1 cut(s) 83
SspMI CTAG 1 cut(s) 467
StuI AGGCCT 1 cut(s) 83
StyI CCWWGG 1 cut(s) 46
TaaI ACNGT 3 cut(s) 170, 211, 233
TaiI ACGT 1 cut(s) 155
TaqI TCGA 3 cut(s) 197, 219, 449
TasI AATT 3 cut(s) 75, 352, 432
TatI WGTACW 1 cut(s) 16
TfiI GAWTC 3 cut(s) 112, 428, 451
Tru1I TTAA 2 cut(s) 285, 496
Tru9I TTAA 2 cut(s) 285, 496
TscAI CASTG 3 cut(s) 45, 140, 238
TspDTI ATGAA 3 cut(s) 72, 118, 456
TspGWI ACGGA 1 cut(s) 363
TspRI CASTG 3 cut(s) 45, 140, 238
XapI RAATTY 1 cut(s) 352
XspI CTAG 1 cut(s) 467
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.