Rorug07G0328500

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0015736
Physical Location & Seq
Reverse (-)
35940241 .. 35941279
1039 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0328500.1

Sequence Viewer

Length: 264 bp
ATGGAGCTCGATAATCTTTTAAAGGAAGAGAGGCTATCAGCATTGTCCTTATTGATACTAGCAAATAAGCAGGACATAAAAGGTTCCCTTACTCTAGAAGAAATTTCCAAGGTTTTGAACTTGGAGGCTATGGATAAAACTCGACACTGGAATATTGTTGGCTGCAGTGCATACACGGGTGAGGGACTGCTTGAGGGATTTGATTGTTGGTCCAAGACATTGCCTCTCAGATCTATGTGCTTGACTAATGCCTGGTCTCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04310 map04310
Pfam Domains
Protein Families
PAE

Protein Analysis

87

Amino Acids

9.8

Weight (kDa)

5.02

Isoelectric Point (pI)

44.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 2 - 72 7.5e-17 ADP-ribosylation factor family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 102
AgsI TTSAA 1 cut(s) 118
AjnI CCWGG 1 cut(s) 251
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
Alw21I GWGCWC 1 cut(s) 9
ApeKI GCWGC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 210
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 1 cut(s) 210
BanII GRGCYC 1 cut(s) 9
Bbv12I GWGCWC 1 cut(s) 9
BbvI GCAGC 1 cut(s) 149
BciT130I CCWGG 1 cut(s) 253
BfaI CTAG 2 cut(s) 59, 95
BfmI CTRYAG 1 cut(s) 163
BglII AGATCT 1 cut(s) 230
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 253
Bme18I GGWCC 1 cut(s) 210
BmgT120I GGNCC 1 cut(s) 210
BmiI GGNNCC 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 253
BpuEI CTTGAG 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 152
Bse3DI GCAATG 1 cut(s) 218
BseBI CCWGG 1 cut(s) 253
BseDI CCNNGG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 218
BseMII CTCAG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 152
BseXI GCAGC 1 cut(s) 149
BsiHKAI GWGCWC 1 cut(s) 9
BslFI GGGAC 1 cut(s) 198
BsmFI GGGAC 1 cut(s) 198
Bsp1286I GDGCHC 1 cut(s) 9
Bsp143I GATC 1 cut(s) 230
BspCNI CTCAG 1 cut(s) 240
BspLI GGNNCC 1 cut(s) 85
BspMAI CTGCAG 1 cut(s) 167
BsrDI GCAATG 1 cut(s) 218
BsrI ACTGG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 230
BssT1I CCWWGG 1 cut(s) 108
Bst2UI CCWGG 1 cut(s) 253
Bst6I CTCTTC 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 227, 258
BstKTI GATC 1 cut(s) 233
BstMBI GATC 1 cut(s) 230
BstNI CCWGG 1 cut(s) 253
BstSCI CCNGG 1 cut(s) 251
BstSFI CTRYAG 1 cut(s) 163
BstV1I GCAGC 1 cut(s) 149
BstX2I RGATCY 1 cut(s) 230
BstYI RGATCY 1 cut(s) 230
BtsI GCAGTG 1 cut(s) 172
BtsIMutI CAGTG 2 cut(s) 145, 172
Cfr13I GGNCC 1 cut(s) 210
CviJI RGCY 4 cut(s) 7, 34, 128, 162
CviKI_1 RGCY 4 cut(s) 7, 34, 128, 162
DdeI CTNAG 2 cut(s) 227, 258
DpnI GATC 1 cut(s) 232
DpnII GATC 1 cut(s) 230
DraI TTTAAA 1 cut(s) 21
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
Ecl136II GAGCTC 1 cut(s) 7
Eco130I CCWWGG 1 cut(s) 108
Eco24I GRGCYC 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 210
Eco53kI GAGCTC 1 cut(s) 7
EcoICRI GAGCTC 1 cut(s) 7
EcoRII CCWGG 1 cut(s) 251
EcoT14I CCWWGG 1 cut(s) 108
EcoT38I GRGCYC 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 108
FaiI YATR 4 cut(s) 77, 131, 172, 236
FalI AAGNNNNNCTT 2 cut(s) 72, 104
FaqI GGGAC 1 cut(s) 198
Fnu4HI GCNGC 1 cut(s) 163
FriOI GRGCYC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 163
FspBI CTAG 2 cut(s) 59, 95
GluI GCNGC 1 cut(s) 163
HphI GGTGA 1 cut(s) 191
Hpy188I TCNGA 1 cut(s) 230
Hpy188III TCNNGA 1 cut(s) 95
HpyCH4V TGCA 2 cut(s) 165, 170
HpyF3I CTNAG 2 cut(s) 227, 258
Kzo9I GATC 1 cut(s) 230
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 56, 133, 238
Lsp1109I GCAGC 1 cut(s) 149
MaeI CTAG 2 cut(s) 59, 95
MalI GATC 1 cut(s) 232
MboI GATC 1 cut(s) 230
MboII GAAGA 2 cut(s) 38, 110
MflI RGATCY 1 cut(s) 230
MhlI GDGCHC 1 cut(s) 9
MluCI AATT 1 cut(s) 102
MnlI CCTC 5 cut(s) 24, 118, 175, 187, 234
MseI TTAA 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 253
MvaI CCWGG 1 cut(s) 253
NdeII GATC 1 cut(s) 230
NlaIV GGNNCC 1 cut(s) 85
PkrI GCNGC 1 cut(s) 164
Psp124BI GAGCTC 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 251
PspGI CCWGG 1 cut(s) 251
PspN4I GGNNCC 1 cut(s) 85
PspPI GGNCC 1 cut(s) 210
PstI CTGCAG 1 cut(s) 167
PsuI RGATCY 1 cut(s) 230
SacI GAGCTC 1 cut(s) 9
SaqAI TTAA 1 cut(s) 20
SatI GCNGC 1 cut(s) 163
Sau3AI GATC 1 cut(s) 230
Sau96I GGNCC 1 cut(s) 210
ScrFI CCNGG 1 cut(s) 253
SduI GDGCHC 1 cut(s) 9
SetI ASST 3 cut(s) 9, 85, 114
SfcI CTRYAG 1 cut(s) 163
SinI GGWCC 1 cut(s) 210
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
Sse9I AATT 1 cut(s) 102
SspI AATATT 1 cut(s) 154
SspMI CTAG 2 cut(s) 59, 95
SstI GAGCTC 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 251
StyI CCWWGG 1 cut(s) 108
TaqI TCGA 2 cut(s) 9, 142
TasI AATT 1 cut(s) 102
Tru1I TTAA 1 cut(s) 20
Tru9I TTAA 1 cut(s) 20
TscAI CASTG 2 cut(s) 152, 172
TseI GCWGC 1 cut(s) 162
TspRI CASTG 2 cut(s) 152, 172
VpaK11BI GGWCC 1 cut(s) 210
XapI RAATTY 1 cut(s) 102
XbaI TCTAGA 1 cut(s) 94
XspI CTAG 2 cut(s) 59, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.