Rorug07G0329600

Metallophosphoesterase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0013686
Physical Location & Seq
Forward (+)
36025959 .. 36026537
579 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0329600.1

Sequence Viewer

Length: 579 bp
ATGGATCTTCTTCAATTTCTTAACATACCCTCTTTGCTTTTGGCATTCAGTTTCCTCATAGTGTTGCTTACATTCCTCTTCAAGGATAGTTCAAGAAAAAGAAAACTTAAACTCCCACCAAGCCCTCCAAAGCTACCTGTTGTTGGCAACCTTCACCAGCTAGGAAACCAGCCTCACCTATCTCTCCGGTCCTTGGCACAAAAGTATGGTCCAATAATTTACTTACAACTTGGTGAGATCCCAACTGTGGTGGTTTCATCAGCTAGAGTTGCCAAGGAAGTACTGAAAACCCATGATCTTGCACTATCAAGCCGTCCACAAATCTTTTCAGCCATACACCTCTTCTATAATTGCACTGATGTTGTCTTCTCCCCTTATGGTGCTTATTGGAGACACATACGTAAGATTTGCATACTTGAGCTGTTAAGTGCCAAAAGAGTGCAGTCATTTAGCCATGCCAGAGAAGAAGAAGTTGCTCGTCTGGCTCGTCGGGTTGACATAGTTAAATACACTAACCGGGTGACACAATGTCAAAGCTCCAATCCTGATGTCAGGATTACTATTTTCTTTGTCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallophos

Protein Analysis

192

Amino Acids

21.91

Weight (kDa)

10.06

Isoelectric Point (pI)

51.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 39 - 166 3.8e-20 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013686)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g37850 FvH4_5g37850
malus_domestica MD15G1365100.v1.1
prunus_persica Prupe.1G513100_v2.0.a1
pyrus_communis pycom15g32740
rosa_chinensis RchiOBHm_Chr7g0239831
rosa_laevigata RLG00000000727
rosa_multiflora Rmu_sc0000540.1_g000066 Rmu_sc0007193.1_g000009
rosa_roxburghii Rroxscaffold_3G00220780
rosa_rugosa Rorug07G0329600 Rorug07G0329700 Rorug07G0329800
rosa_samantha Rh7AG483800 Rh7BG456800 Rh7CG501300 Rh7DG469500
rosa_wichuraiana Rw7G040580

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 12, 232
AfaI GTAC 1 cut(s) 282
AfiI CCNNNNNNNGG 4 cut(s) 82, 143, 193, 247
AgsI TTSAA 3 cut(s) 14, 82, 93
AhdI GACNNNNNGTC 1 cut(s) 528
AluBI AGCT 5 cut(s) 133, 160, 263, 421, 537
AluI AGCT 5 cut(s) 133, 160, 263, 421, 537
Alw26I GTCTC 1 cut(s) 385
AlwI GGATC 2 cut(s) 12, 232
ArsI GACNNNNNNTTYG 2 cut(s) 193, 225
AspS9I GGNCC 2 cut(s) 189, 209
AsuC2I CCSGG 1 cut(s) 518
AsuHPI GGTGA 4 cut(s) 146, 167, 245, 532
AvaII GGWCC 2 cut(s) 189, 209
BbsI GAAGAC 1 cut(s) 358
BceAI ACGGC 1 cut(s) 297
BcnI CCSGG 1 cut(s) 518
BcoDI GTCTC 1 cut(s) 385
BfaI CTAG 2 cut(s) 161, 264
BmcAI AGTACT 1 cut(s) 282
Bme1390I CCNGG 1 cut(s) 518
Bme18I GGWCC 2 cut(s) 189, 209
BmeRI GACNNNNNGTC 1 cut(s) 528
BmgT120I GGNCC 2 cut(s) 189, 209
BmrFI CCNGG 1 cut(s) 518
BpiI GAAGAC 1 cut(s) 358
BpuEI CTTGAG 1 cut(s) 437
BpuMI CCSGG 1 cut(s) 518
BsaAI YACGTR 1 cut(s) 401
BsaJI CCNNGG 2 cut(s) 192, 273
BsaWI WCCGGW 1 cut(s) 186
BsaXI ACNNNNNCTCC 2 cut(s) 96, 126
Bsc4I CCNNNNNNNGG 4 cut(s) 82, 143, 193, 247
BseDI CCNNGG 2 cut(s) 192, 273
BseLI CCNNNNNNNGG 4 cut(s) 82, 143, 193, 247
BsgI GTGCAG 1 cut(s) 461
BsiSI CCGG 2 cut(s) 187, 517
BslI CCNNNNNNNGG 4 cut(s) 82, 143, 193, 247
BsmAI GTCTC 1 cut(s) 385
BsmI GAATGC 1 cut(s) 44
Bsp143I GATC 3 cut(s) 4, 237, 295
BspPI GGATC 2 cut(s) 12, 232
BssECI CCNNGG 2 cut(s) 192, 273
BssMI GATC 3 cut(s) 4, 237, 295
BssT1I CCWWGG 2 cut(s) 192, 273
Bst4CI ACNGT 1 cut(s) 247
Bst6I CTCTTC 2 cut(s) 83, 347
BstBAI YACGTR 1 cut(s) 401
BstENI CCTNNNNNAGG 1 cut(s) 80
BstKTI GATC 3 cut(s) 7, 240, 298
BstMAI GTCTC 1 cut(s) 385
BstMBI GATC 3 cut(s) 4, 237, 295
BstMWI GCNNNNNNNGC 2 cut(s) 269, 482
BstSCI CCNGG 1 cut(s) 516
BstSNI TACGTA 1 cut(s) 401
BstV2I GAAGAC 1 cut(s) 358
BstX2I RGATCY 2 cut(s) 4, 237
BstYI RGATCY 2 cut(s) 4, 237
BtsIMutI CAGTG 1 cut(s) 354
Cfr13I GGNCC 2 cut(s) 189, 209
Csp6I GTAC 1 cut(s) 281
CspCI CAANNNNNGTGG 2 cut(s) 231, 266
CviAII CATG 2 cut(s) 293, 455
CviQI GTAC 1 cut(s) 281
DpnI GATC 3 cut(s) 6, 239, 297
DpnII GATC 3 cut(s) 4, 237, 295
DriI GACNNNNNGTC 1 cut(s) 528
Eam1104I CTCTTC 2 cut(s) 83, 347
Eam1105I GACNNNNNGTC 1 cut(s) 528
EarI CTCTTC 2 cut(s) 83, 347
Eco105I TACGTA 1 cut(s) 401
Eco130I CCWWGG 2 cut(s) 192, 273
Eco47I GGWCC 2 cut(s) 189, 209
EcoNI CCTNNNNNAGG 1 cut(s) 80
EcoT14I CCWWGG 2 cut(s) 192, 273
ErhI CCWWGG 2 cut(s) 192, 273
FaeI CATG 2 cut(s) 296, 458
FatI CATG 2 cut(s) 292, 454
FspBI CTAG 2 cut(s) 161, 264
HapII CCGG 2 cut(s) 187, 517
Hin1II CATG 2 cut(s) 296, 458
HincII GTYRAC 1 cut(s) 496
HindII GTYRAC 1 cut(s) 496
HpaII CCGG 2 cut(s) 187, 517
HphI GGTGA 4 cut(s) 146, 167, 245, 532
Hpy166II GTNNAC 2 cut(s) 317, 496
Hpy188III TCNNGA 3 cut(s) 93, 545, 553
Hpy8I GTNNAC 2 cut(s) 317, 496
Hpy99I CGWCG 1 cut(s) 492
HpyAV CCTTC 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 247
HpyCH4IV ACGT 1 cut(s) 400
HpyCH4V TGCA 4 cut(s) 302, 354, 411, 442
HpyF10VI GCNNNNNNNGC 2 cut(s) 269, 482
HpySE526I ACGT 1 cut(s) 400
Hsp92II CATG 2 cut(s) 296, 458
Kzo9I GATC 3 cut(s) 4, 237, 295
LmnI GCTCC 1 cut(s) 542
LpnPI CCDG 9 cut(s) 150, 170, 182, 200, 467, 472, 530, 538, 558
MaeI CTAG 2 cut(s) 161, 264
MaeII ACGT 1 cut(s) 400
MaeIII GTNAC 1 cut(s) 520
MalI GATC 3 cut(s) 6, 239, 297
MboI GATC 3 cut(s) 4, 237, 295
MboII GAAGA 5 cut(s) 70, 334, 358, 476, 479
MfeI CAATTG 1 cut(s) 574
MflI RGATCY 2 cut(s) 4, 237
MluCI AATT 4 cut(s) 14, 216, 349, 574
MnlI CCTC 6 cut(s) 40, 65, 86, 135, 183, 350
MseI TTAA 4 cut(s) 21, 108, 425, 504
MspI CCGG 2 cut(s) 187, 517
MspR9I CCNGG 1 cut(s) 518
MunI CAATTG 1 cut(s) 574
Mva1269I GAATGC 1 cut(s) 44
MwoI GCNNNNNNNGC 2 cut(s) 269, 482
NciI CCSGG 1 cut(s) 518
NdeII GATC 3 cut(s) 4, 237, 295
NlaIII CATG 2 cut(s) 296, 458
NmuCI GTSAC 1 cut(s) 520
PcsI WCGNNNNNNNCGW 1 cut(s) 484
PctI GAATGC 1 cut(s) 44
Ppu21I YACGTR 1 cut(s) 401
PspPI GGNCC 2 cut(s) 189, 209
PsuI RGATCY 2 cut(s) 4, 237
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
SaqAI TTAA 4 cut(s) 21, 108, 425, 504
Sau3AI GATC 3 cut(s) 4, 237, 295
Sau96I GGNCC 2 cut(s) 189, 209
ScaI AGTACT 1 cut(s) 282
ScrFI CCNGG 1 cut(s) 518
SinI GGWCC 2 cut(s) 189, 209
SmlI CTYRAG 1 cut(s) 416
SmoI CTYRAG 1 cut(s) 416
SnaBI TACGTA 1 cut(s) 401
Sse9I AATT 4 cut(s) 14, 216, 349, 574
SspMI CTAG 2 cut(s) 161, 264
StyD4I CCNGG 1 cut(s) 516
StyI CCWWGG 2 cut(s) 192, 273
TaaI ACNGT 1 cut(s) 247
TaiI ACGT 1 cut(s) 403
TasI AATT 4 cut(s) 14, 216, 349, 574
TatI WGTACW 1 cut(s) 280
Tru1I TTAA 4 cut(s) 21, 108, 425, 504
Tru9I TTAA 4 cut(s) 21, 108, 425, 504
TscAI CASTG 1 cut(s) 361
TseFI GTSAC 1 cut(s) 520
Tsp45I GTSAC 1 cut(s) 520
TspDTI ATGAA 1 cut(s) 246
TspRI CASTG 1 cut(s) 361
VpaK11BI GGWCC 2 cut(s) 189, 209
XagI CCTNNNNNAGG 1 cut(s) 80
XspI CTAG 2 cut(s) 161, 264
ZrmI AGTACT 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.