Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr1A

Orthogroup ID

OG0010635

Physical Location & Seq

Genomic Coordinates Forward (+)

65359888 .. 65367148

Gene Structure 7261 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh1AG424300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 408 bp

ATGGAGTGTCAGAAGAAGTTGATAGCTAGCCGTAAGGTTAGGTCGGCAGGCTTGACTCTCCAAATTATTGACCAATTAGCTAGTTCCCAGGGACATCACCAGTCTAGTCTTTCTAAGGGAAAAGCAGAGATTGAATCTCATGTGCAACCTGGATCTGTATCAAAAGTTGTTCTATTTCTGTCTCATATTTGTATTGAGTTTGCATATCGTTATAACACCGCCCTGGTTTGCCACAGATGGCTTTTCTTGGCATGCCACCCTCGCTTATGGCTGCAAGTTGAACGATCCATTAAAGATCCATTGGAGCCTGGCGTCTTCCCCAGCATTGAGACAGCGGTTACTGCCGCAAGGCCTGGCGACACCATTCTAATTTCAGCAGGGGAAAAGCATCTTGCTTCTGATATTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box-like

Protein Analysis

135

Amino Acids

14.91

Weight (kDa)

8.77

Isoelectric Point (pI)

63.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010635)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0001460.1_g000008 Rmu_sc0003441.1_g000021
rosa_roxburghii	Rroxscaffold_4G00308150 Rroxscaffold_5G00370200 Rroxscaffold_6G00400510 Rroxscaffold_7G00188210
rosa_rugosa	Rorug01G0131700.1 Rorug03G0291900 Rorug04G0439200 Rorug07G0306700
rosa_samantha	Rh1AG309500 Rh1AG424300 Rh1BG121100 Rh2CG398400 Rh3DG152800 Rh3DG152900 Rh3DG257600 Rh4AG226900 Rh4BG233000 Rh7AG422800
rosa_wichuraiana	Rw6G014060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	213
AciI	CCGC	3 cut(s)	219, 335, 345
AclWI	GGATC	3 cut(s)	160, 279, 290
AcyI	GRCGYC	1 cut(s)	312
AgsI	TTSAA	2 cut(s)	134, 281
AjnI	CCWGG	5 cut(s)	87, 148, 222, 307, 352
AluBI	AGCT	2 cut(s)	26, 80
AluI	AGCT	2 cut(s)	26, 80
Alw26I	GTCTC	2 cut(s)	186, 323
AlwI	GGATC	3 cut(s)	160, 279, 290
AoxI	GGCC	1 cut(s)	350
ApeKI	GCWGC	1 cut(s)	271
AsuHPI	GGTGA	1 cut(s)	89
AsuNHI	GCTAGC	1 cut(s)	26
BbsI	GAAGAC	1 cut(s)	307
BbvI	GCAGC	1 cut(s)	258
BccI	CCATC	1 cut(s)	231
BceAI	ACGGC	1 cut(s)	15
BciT130I	CCWGG	5 cut(s)	89, 150, 224, 309, 354
BcoDI	GTCTC	2 cut(s)	186, 323
BfaI	CTAG	3 cut(s)	27, 81, 105
BisI	GCNGC	2 cut(s)	272, 345
BlsI	GCNGC	2 cut(s)	273, 346
Bme1390I	CCNGG	5 cut(s)	89, 150, 224, 309, 354
BmiI	GGNNCC	1 cut(s)	306
BmrFI	CCNGG	5 cut(s)	89, 150, 224, 309, 354
BmsI	GCATC	1 cut(s)	397
BmtI	GCTAGC	1 cut(s)	30
BpiI	GAAGAC	1 cut(s)	307
BsaBI	GATNNNNATC	1 cut(s)	157
BsaHI	GRCGYC	1 cut(s)	312
BsaJI	CCNNGG	3 cut(s)	87, 88, 222
Bse1I	ACTGG	1 cut(s)	100
Bse8I	GATNNNNATC	1 cut(s)	157
BseBI	CCWGG	5 cut(s)	89, 150, 224, 309, 354
BseDI	CCNNGG	3 cut(s)	87, 88, 222
BseJI	GATNNNNATC	1 cut(s)	157
BseNI	ACTGG	1 cut(s)	100
BseXI	GCAGC	1 cut(s)	258
BseYI	CCCAGC	1 cut(s)	320
BshFI	GGCC	1 cut(s)	352
BslFI	GGGAC	1 cut(s)	105
BsmAI	GTCTC	2 cut(s)	186, 323
BsmFI	GGGAC	1 cut(s)	105
BsnI	GGCC	1 cut(s)	352
Bsp143I	GATC	3 cut(s)	152, 284, 295
BspACI	CCGC	3 cut(s)	219, 335, 345
BspANI	GGCC	1 cut(s)	352
BspLI	GGNNCC	1 cut(s)	306
BspOI	GCTAGC	1 cut(s)	30
BspPI	GGATC	3 cut(s)	160, 279, 290
BsrI	ACTGG	1 cut(s)	100
BssECI	CCNNGG	3 cut(s)	87, 88, 222
BssMI	GATC	3 cut(s)	152, 284, 295
BssNI	GRCGYC	1 cut(s)	312
Bst2UI	CCWGG	5 cut(s)	89, 150, 224, 309, 354
BstACI	GRCGYC	1 cut(s)	312
BstC8I	GCNNGC	3 cut(s)	28, 49, 253
BstDEI	CTNAG	1 cut(s)	114
BstKTI	GATC	3 cut(s)	155, 287, 298
BstMAI	GTCTC	2 cut(s)	186, 323
BstMBI	GATC	3 cut(s)	152, 284, 295
BstMWI	GCNNNNNNNGC	2 cut(s)	261, 341
BstNI	CCWGG	5 cut(s)	89, 150, 224, 309, 354
BstNSI	RCATGY	1 cut(s)	255
BstSCI	CCNGG	5 cut(s)	87, 148, 222, 307, 352
BstV1I	GCAGC	1 cut(s)	258
BstV2I	GAAGAC	1 cut(s)	307
BstX2I	RGATCY	2 cut(s)	152, 295
BstYI	RGATCY	2 cut(s)	152, 295
BsuRI	GGCC	1 cut(s)	352
Cac8I	GCNNGC	3 cut(s)	28, 49, 253
CseI	GACGC	1 cut(s)	301
CviAII	CATG	2 cut(s)	140, 252
CviJI	RGCY	8 cut(s)	26, 30, 51, 80, 241, 271, 307, 352
CviKI_1	RGCY	8 cut(s)	26, 30, 51, 80, 241, 271, 307, 352
DdeI	CTNAG	1 cut(s)	114
DpnI	GATC	3 cut(s)	154, 286, 297
DpnII	GATC	3 cut(s)	152, 284, 295
Eco147I	AGGCCT	1 cut(s)	352
EcoRII	CCWGG	5 cut(s)	87, 148, 222, 307, 352
FaeI	CATG	2 cut(s)	143, 255
FaiI	YATR	6 cut(s)	141, 186, 205, 213, 253, 268
FaqI	GGGAC	1 cut(s)	105
FatI	CATG	2 cut(s)	139, 251
Fnu4HI	GCNGC	2 cut(s)	272, 345
Fsp4HI	GCNGC	2 cut(s)	272, 345
FspBI	CTAG	3 cut(s)	27, 81, 105
GluI	GCNGC	2 cut(s)	272, 345
GsaI	CCCAGC	1 cut(s)	324
HaeIII	GGCC	1 cut(s)	352
HgaI	GACGC	1 cut(s)	301
Hin1I	GRCGYC	1 cut(s)	312
Hin1II	CATG	2 cut(s)	143, 255
HinfI	GANTC	2 cut(s)	55, 134
HphI	GGTGA	1 cut(s)	89
Hpy188I	TCNGA	2 cut(s)	12, 400
HpyCH4V	TGCA	3 cut(s)	145, 203, 274
HpyF10VI	GCNNNNNNNGC	2 cut(s)	261, 341
HpyF3I	CTNAG	1 cut(s)	114
Hsp92I	GRCGYC	1 cut(s)	312
Hsp92II	CATG	2 cut(s)	143, 255
Kzo9I	GATC	3 cut(s)	152, 284, 295
LmnI	GCTCC	1 cut(s)	304
Lsp1109I	GCAGC	1 cut(s)	258
LweI	GCATC	1 cut(s)	397
MaeI	CTAG	3 cut(s)	27, 81, 105
MaeIII	GTNAC	1 cut(s)	337
MalI	GATC	3 cut(s)	154, 286, 297
MboI	GATC	3 cut(s)	152, 284, 295
MboII	GAAGA	2 cut(s)	25, 307
MflI	RGATCY	2 cut(s)	152, 295
MluCI	AATT	3 cut(s)	63, 74, 369
MlyI	GAGTC	1 cut(s)	49
MnlI	CCTC	1 cut(s)	270
MseI	TTAA	2 cut(s)	291, 406
MspA1I	CMGCKG	1 cut(s)	335
MspR9I	CCNGG	5 cut(s)	89, 150, 224, 309, 354
MvaI	CCWGG	5 cut(s)	89, 150, 224, 309, 354
MwoI	GCNNNNNNNGC	2 cut(s)	261, 341
NdeII	GATC	3 cut(s)	152, 284, 295
NheI	GCTAGC	1 cut(s)	26
NlaIII	CATG	2 cut(s)	143, 255
NlaIV	GGNNCC	1 cut(s)	306
NspI	RCATGY	1 cut(s)	255
PaeI	GCATGC	1 cut(s)	255
PasI	CCCWGGG	1 cut(s)	88
PceI	AGGCCT	1 cut(s)	352
PfeI	GAWTC	1 cut(s)	134
PkrI	GCNGC	2 cut(s)	273, 346
PleI	GAGTC	1 cut(s)	49
PpsI	GAGTC	1 cut(s)	49
PsiI	TTATAA	1 cut(s)	213
Psp6I	CCWGG	5 cut(s)	87, 148, 222, 307, 352
PspFI	CCCAGC	1 cut(s)	320
PspGI	CCWGG	5 cut(s)	87, 148, 222, 307, 352
PspN4I	GGNNCC	1 cut(s)	306
PsuI	RGATCY	2 cut(s)	152, 295
SaqAI	TTAA	2 cut(s)	291, 406
SatI	GCNGC	2 cut(s)	272, 345
Sau3AI	GATC	3 cut(s)	152, 284, 295
SchI	GAGTC	1 cut(s)	49
ScrFI	CCNGG	5 cut(s)	89, 150, 224, 309, 354
SetI	ASST	5 cut(s)	28, 39, 44, 82, 151
SfaNI	GCATC	1 cut(s)	397
SphI	GCATGC	1 cut(s)	255
Sse9I	AATT	3 cut(s)	63, 74, 369
SseBI	AGGCCT	1 cut(s)	352
SsiI	CCGC	3 cut(s)	219, 335, 345
SspMI	CTAG	3 cut(s)	27, 81, 105
StuI	AGGCCT	1 cut(s)	352
StyD4I	CCNGG	5 cut(s)	87, 148, 222, 307, 352
TasI	AATT	3 cut(s)	63, 74, 369
TauI	GCSGC	1 cut(s)	347
TfiI	GAWTC	1 cut(s)	134
Tru1I	TTAA	2 cut(s)	291, 406
Tru9I	TTAA	2 cut(s)	291, 406
TseI	GCWGC	1 cut(s)	271
XceI	RCATGY	1 cut(s)	255
XspI	CTAG	3 cut(s)	27, 81, 105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.