Rh1CG245300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
50608722 .. 50623902
15181 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG245300.1

Sequence Viewer

Length: 294 bp
ATGGGGGATTTGTACGCTTTGGATTTCGACGGAGTTCTGTGCGATAGCTGCGGAGAGAGCTATGCCACTGCTGCCAAGTTGCAGCCACAAGATAGAAATACTGAAGCAGCTTCAAGAGAAAGCAGAACATCAAGGGCTGAAGCTGCATTCCAGCCGCAAGATAGAAGTACTGAAGCAGCTTCAAGAGAAACCAGAACATCAAGGGCTGAAGCTGCAGGATTTGGGAAGGAGTTGTTGGAGAAGGAGGTGACGAAGGCTGCAGAGCCGCTGTCATCTCGCACACTAACCCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.47

Weight (kDa)

4.85

Isoelectric Point (pI)

61.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 51, 155, 266
AcuI CTGAAG 4 cut(s) 123, 159, 192, 228
AfaI GTAC 2 cut(s) 14, 169
AgsI TTSAA 2 cut(s) 114, 183
AjuI GAANNNNNNNTTGG 2 cut(s) 218, 250
AluBI AGCT 6 cut(s) 48, 60, 110, 143, 179, 212
AluI AGCT 6 cut(s) 48, 60, 110, 143, 179, 212
ApeKI GCWGC 8 cut(s) 48, 71, 82, 107, 143, 176, 212, 257
AsuHPI GGTGA 1 cut(s) 259
BbvI GCAGC 8 cut(s) 35, 58, 94, 119, 130, 188, 199, 244
BfmI CTRYAG 2 cut(s) 213, 258
BmcAI AGTACT 1 cut(s) 169
BseXI GCAGC 8 cut(s) 35, 58, 94, 119, 130, 188, 199, 244
BsmI GAATGC 1 cut(s) 146
BspACI CCGC 3 cut(s) 51, 155, 266
BspMAI CTGCAG 2 cut(s) 217, 262
BstMWI GCNNNNNNNGC 5 cut(s) 48, 57, 71, 143, 212
BstSFI CTRYAG 2 cut(s) 213, 258
BstV1I GCAGC 8 cut(s) 35, 58, 94, 119, 130, 188, 199, 244
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
Csp6I GTAC 2 cut(s) 13, 168
CviAII CATG 1 cut(s) 291
CviQI GTAC 2 cut(s) 13, 168
Eco57I CTGAAG 4 cut(s) 123, 159, 192, 228
FaeI CATG 1 cut(s) 294
FaiI YATR 2 cut(s) 63, 292
FatI CATG 1 cut(s) 290
Hin1II CATG 1 cut(s) 294
HphI GGTGA 1 cut(s) 259
Hpy188III TCNNGA 2 cut(s) 114, 183
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 3 cut(s) 220, 235, 247
HpyCH4V TGCA 4 cut(s) 82, 146, 215, 260
HpyF10VI GCNNNNNNNGC 5 cut(s) 48, 57, 71, 143, 212
Hsp92II CATG 1 cut(s) 294
LpnPI CCDG 3 cut(s) 164, 201, 205
Lsp1109I GCAGC 8 cut(s) 35, 58, 94, 119, 130, 188, 199, 244
MaeIII GTNAC 1 cut(s) 247
MmeI TCCRAC 1 cut(s) 216
MnlI CCTC 1 cut(s) 238
MspA1I CMGCKG 1 cut(s) 268
Mva1269I GAATGC 1 cut(s) 146
MwoI GCNNNNNNNGC 5 cut(s) 48, 57, 71, 143, 212
NlaIII CATG 1 cut(s) 294
NmuCI GTSAC 1 cut(s) 247
PctI GAATGC 1 cut(s) 146
PstI CTGCAG 2 cut(s) 217, 262
RsaI GTAC 2 cut(s) 14, 169
RsaNI GTAC 2 cut(s) 13, 168
ScaI AGTACT 1 cut(s) 169
SetI ASST 7 cut(s) 50, 62, 112, 145, 181, 214, 249
SfcI CTRYAG 2 cut(s) 213, 258
SsiI CCGC 3 cut(s) 51, 155, 266
TaqI TCGA 1 cut(s) 27
TatI WGTACW 1 cut(s) 167
TauI GCSGC 2 cut(s) 157, 268
TscAI CASTG 1 cut(s) 73
TseFI GTSAC 1 cut(s) 247
TseI GCWGC 8 cut(s) 48, 71, 82, 107, 143, 176, 212, 257
Tsp45I GTSAC 1 cut(s) 247
TspGWI ACGGA 1 cut(s) 45
TspRI CASTG 1 cut(s) 73
ZrmI AGTACT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.