Rh1DG147100
ERF Family

Belongs to the TRAFAC class dynamin-like GTPase superfamily. Dynamin Fzo YdjA family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
30816466 .. 30824684
8219 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG147100.1

Sequence Viewer

Length: 219 bp
ATGGGCAAAGGAACTAATATTATGGATAATATAAGGATAGTGGTTTCAGAGGCTGATGGTTATCAGCCTCACTTAATTGCCCCAGAGCAAGGTTACCACCGCCTTATTGAGGGATCACTGAATTATTTTAGAGGCCCAGCTGAGGTTTCTGTTCATGCTGGTAAGCAGTTGGGTCAGATACTTGATGATGACTTGATGGAGAGGAGGCTACAGTGCTAA

Protein Analysis

72

Amino Acids

8.07

Weight (kDa)

5.43

Isoelectric Point (pI)

50.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 100
AclWI GGATC 1 cut(s) 121
AfiI CCNNNNNNNGG 3 cut(s) 89, 109, 142
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AlwI GGATC 1 cut(s) 121
AlwNI CAGNNNCTG 1 cut(s) 53
AoxI GGCC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 134
BbvCI CCTCAGC 1 cut(s) 141
BccI CCATC 2 cut(s) 50, 190
BfmI CTRYAG 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 134
Bpu10I CCTNAGC 1 cut(s) 141
BsaBI GATNNNNATC 1 cut(s) 60
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 109, 142
Bse8I GATNNNNATC 1 cut(s) 60
BseJI GATNNNNATC 1 cut(s) 60
BseLI CCNNNNNNNGG 3 cut(s) 89, 109, 142
BseMII CTCAG 1 cut(s) 132
BseRI GAGGAG 1 cut(s) 217
BseYI CCCAGC 1 cut(s) 136
BshFI GGCC 1 cut(s) 135
BslI CCNNNNNNNGG 3 cut(s) 89, 109, 142
BsnI GGCC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 113
BspACI CCGC 1 cut(s) 100
BspANI GGCC 1 cut(s) 135
BspCNI CTCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 121
BssMI GATC 1 cut(s) 113
Bst4CI ACNGT 1 cut(s) 213
BstDEI CTNAG 1 cut(s) 141
BstEII GGTNACC 1 cut(s) 92
BstENI CCTNNNNNAGG 1 cut(s) 107
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstPI GGTNACC 1 cut(s) 92
BstSFI CTRYAG 1 cut(s) 209
BsuRI GGCC 1 cut(s) 135
BtsIMutI CAGTG 2 cut(s) 116, 218
CaiI CAGNNNCTG 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 134
CviAII CATG 1 cut(s) 155
CviJI RGCY 5 cut(s) 53, 67, 135, 140, 208
CviKI_1 RGCY 5 cut(s) 53, 67, 135, 140, 208
DdeI CTNAG 1 cut(s) 141
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
Eco91I GGTNACC 1 cut(s) 92
EcoNI CCTNNNNNAGG 1 cut(s) 107
EcoO65I GGTNACC 1 cut(s) 92
FaeI CATG 1 cut(s) 158
FaiI YATR 3 cut(s) 23, 32, 156
FatI CATG 1 cut(s) 154
GsaI CCCAGC 1 cut(s) 140
HaeIII GGCC 1 cut(s) 135
Hin1II CATG 1 cut(s) 158
Hpy188I TCNGA 2 cut(s) 49, 177
HpyCH4III ACNGT 1 cut(s) 213
HpyF3I CTNAG 1 cut(s) 141
Hsp92II CATG 1 cut(s) 158
Kzo9I GATC 1 cut(s) 113
LpnPI CCDG 3 cut(s) 96, 144, 150
MaeIII GTNAC 1 cut(s) 92
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MluCI AATT 2 cut(s) 75, 121
MnlI CCTC 7 cut(s) 43, 78, 103, 125, 136, 195, 198
MseI TTAA 1 cut(s) 74
MspA1I CMGCKG 1 cut(s) 140
NdeII GATC 1 cut(s) 113
NlaIII CATG 1 cut(s) 158
PspEI GGTNACC 1 cut(s) 92
PspFI CCCAGC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 134
PstNI CAGNNNCTG 1 cut(s) 53
PvuII CAGCTG 1 cut(s) 140
SaqAI TTAA 1 cut(s) 74
Sau3AI GATC 1 cut(s) 113
Sau96I GGNCC 1 cut(s) 134
SetI ASST 3 cut(s) 94, 142, 147
SfcI CTRYAG 1 cut(s) 209
SgeI CNNG 7 cut(s) 95, 101, 149, 167, 171, 194, 205
Sse9I AATT 2 cut(s) 75, 121
SsiI CCGC 1 cut(s) 100
SspI AATATT 1 cut(s) 19
TaaI ACNGT 1 cut(s) 213
TasI AATT 2 cut(s) 75, 121
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TscAI CASTG 2 cut(s) 123, 218
TspDTI ATGAA 1 cut(s) 143
TspRI CASTG 2 cut(s) 123, 218
XagI CCTNNNNNAGG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.