Rh2CG110800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0014297
Physical Location & Seq
Forward (+)
9752297 .. 9752740
444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG110800.1

Sequence Viewer

Length: 444 bp
ATGCAGGATTCAAAGATTCCCCTTTCGGATGAATTTTCGATTCCCAAGTCACGGAAGAAGAAAGTCTCTGCCCAGAAAGGCCCCTTGTTTCAGGTACAAGGGAATGATGTGAATGGGGCTCCTTCTCTTCCTCTAAAAGCTGGGAACAAACCATCCAAAAGGAACTTGAAGAGGGAAGTTTCTCCAATGGTCCAGCAACCAGAGAGGTCAAACTCAAATTCGCTGCCTGATTCATCTTCGTCTGGAAGCAACTACCGTGAGCTAAGGCTCAAGTACTTGATGATGGAGGAAGAGAGCTTTGCAGTGGGGAAAGATCTACGAGAGGTTGAAGACGAGGTCAAGACCCTTGAGGAGGAGAAGTTTGCACTCTTGGATGAGCTTGTTGTGTTAGAAGGCCTCGTTGATCCTTCAGAGTTGCACCCCCAGGGGTTGCATTCATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.38

Weight (kDa)

5.52

Isoelectric Point (pI)

48.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014297)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G51500
fragaria_vesca FvH4_1g09810 FvH4_1g09810
malus_domestica MD02G1107400.v1.1 MD15G1226600.v1.1
prunus_persica Prupe.7G188600_v2.0.a1
pyrus_communis pycom15g20150
rosa_chinensis RchiOBHm_Chr2g0096641
rosa_laevigata RLG00000016657
rosa_multiflora Rmu_sc0003565.1_g000016
rosa_roxburghii Rroxscaffold_2G00145460
rosa_rugosa Rorug02G0059200
rosa_samantha Rh2AG106600 Rh2BG109000 Rh2CG110800 Rh2DG110300
rosa_wichuraiana Rw2G008250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 398
AcsI RAATTY 2 cut(s) 32, 217
AcuI CTGAAG 1 cut(s) 393
AfaI GTAC 2 cut(s) 96, 275
AfiI CCNNNNNNNGG 2 cut(s) 51, 352
AgsI TTSAA 3 cut(s) 12, 169, 329
AjnI CCWGG 1 cut(s) 423
AloI GAACNNNNNNTCC 2 cut(s) 137, 169
AluBI AGCT 4 cut(s) 140, 262, 297, 379
AluI AGCT 4 cut(s) 140, 262, 297, 379
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 398
AoxI GGCC 2 cut(s) 79, 394
ApeKI GCWGC 1 cut(s) 223
ApoI RAATTY 2 cut(s) 32, 217
AspS9I GGNCC 2 cut(s) 80, 190
AvaII GGWCC 1 cut(s) 190
BanII GRGCYC 1 cut(s) 121
BbsI GAAGAC 1 cut(s) 336
BbvI GCAGC 1 cut(s) 210
BccI CCATC 2 cut(s) 160, 277
BciT130I CCWGG 1 cut(s) 425
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 442
BglII AGATCT 1 cut(s) 313
BisI GCNGC 1 cut(s) 224
BlsI GCNGC 1 cut(s) 225
BmcAI AGTACT 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 425
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 2 cut(s) 80, 190
BmiI GGNNCC 2 cut(s) 82, 120
BmrFI CCNGG 1 cut(s) 425
BpiI GAAGAC 1 cut(s) 336
Bpu10I CCTNAGC 1 cut(s) 263
BpuEI CTTGAG 2 cut(s) 254, 368
BsaJI CCNNGG 2 cut(s) 423, 424
BsaXI ACNNNNNCTCC 2 cut(s) 344, 374
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 352
BseBI CCWGG 1 cut(s) 425
BseDI CCNNGG 2 cut(s) 423, 424
BseGI GGATG 4 cut(s) 34, 152, 379, 437
BseLI CCNNNNNNNGG 2 cut(s) 51, 352
BseRI GAGGAG 2 cut(s) 365, 368
BseXI GCAGC 1 cut(s) 210
BseYI CCCAGC 1 cut(s) 140
BshFI GGCC 2 cut(s) 81, 396
BslI CCNNNNNNNGG 2 cut(s) 51, 352
BsmAI GTCTC 1 cut(s) 70
BsmI GAATGC 1 cut(s) 433
BsnI GGCC 2 cut(s) 81, 396
Bsp1286I GDGCHC 1 cut(s) 121
Bsp143I GATC 2 cut(s) 313, 403
BspANI GGCC 2 cut(s) 81, 396
BspLI GGNNCC 2 cut(s) 82, 120
BspPI GGATC 1 cut(s) 398
BssECI CCNNGG 2 cut(s) 423, 424
BssMI GATC 2 cut(s) 313, 403
Bst2UI CCWGG 1 cut(s) 425
Bst4CI ACNGT 1 cut(s) 257
Bst6I CTCTTC 3 cut(s) 132, 164, 285
BstDEI CTNAG 1 cut(s) 263
BstENI CCTNNNNNAGG 1 cut(s) 350
BstF5I GGATG 4 cut(s) 34, 152, 379, 437
BstKTI GATC 2 cut(s) 316, 406
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 2 cut(s) 313, 403
BstNI CCWGG 1 cut(s) 425
BstSCI CCNGG 1 cut(s) 423
BstV1I GCAGC 1 cut(s) 210
BstV2I GAAGAC 1 cut(s) 336
BstX2I RGATCY 1 cut(s) 313
BstYI RGATCY 1 cut(s) 313
BsuRI GGCC 2 cut(s) 81, 396
BtsCI GGATG 4 cut(s) 34, 152, 379, 437
BtsI GCAGTG 1 cut(s) 309
BtsIMutI CAGTG 1 cut(s) 309
Cfr13I GGNCC 2 cut(s) 80, 190
Csp6I GTAC 2 cut(s) 95, 274
CviJI RGCY 8 cut(s) 81, 119, 140, 262, 268, 297, 379, 396
CviKI_1 RGCY 8 cut(s) 81, 119, 140, 262, 268, 297, 379, 396
CviQI GTAC 2 cut(s) 95, 274
DdeI CTNAG 1 cut(s) 263
DpnI GATC 2 cut(s) 315, 405
DpnII GATC 2 cut(s) 313, 403
Eam1104I CTCTTC 3 cut(s) 132, 164, 285
EarI CTCTTC 3 cut(s) 132, 164, 285
Eco147I AGGCCT 1 cut(s) 396
Eco24I GRGCYC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 190
Eco57I CTGAAG 1 cut(s) 393
EcoNI CCTNNNNNAGG 1 cut(s) 350
EcoO109I RGGNCCY 1 cut(s) 80
EcoRII CCWGG 1 cut(s) 423
EcoT38I GRGCYC 1 cut(s) 121
Fnu4HI GCNGC 1 cut(s) 224
FokI GGATG 4 cut(s) 41, 139, 386, 424
FriOI GRGCYC 1 cut(s) 121
Fsp4HI GCNGC 1 cut(s) 224
FspBI CTAG 1 cut(s) 442
GluI GCNGC 1 cut(s) 224
GsaI CCCAGC 1 cut(s) 144
HaeIII GGCC 2 cut(s) 81, 396
HinfI GANTC 4 cut(s) 8, 16, 40, 230
Hpy188I TCNGA 2 cut(s) 28, 412
Hpy188III TCNNGA 2 cut(s) 243, 340
HpyAV CCTTC 3 cut(s) 132, 386, 417
HpyCH4III ACNGT 1 cut(s) 257
HpyCH4V TGCA 5 cut(s) 4, 302, 365, 418, 433
HpyF3I CTNAG 1 cut(s) 263
Kzo9I GATC 2 cut(s) 313, 403
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 9 cut(s) 77, 86, 126, 206, 213, 228, 240, 410, 437
Lsp1109I GCAGC 1 cut(s) 210
MaeI CTAG 1 cut(s) 442
MaeIII GTNAC 1 cut(s) 48
MalI GATC 2 cut(s) 315, 405
MboI GATC 2 cut(s) 313, 403
MboII GAAGA 7 cut(s) 67, 70, 119, 181, 228, 302, 341
MflI RGATCY 1 cut(s) 313
MhlI GDGCHC 1 cut(s) 121
MluCI AATT 2 cut(s) 32, 217
MnlI CCTC 9 cut(s) 141, 165, 198, 280, 316, 328, 343, 346, 407
MspR9I CCNGG 1 cut(s) 425
Mva1269I GAATGC 1 cut(s) 433
MvaI CCWGG 1 cut(s) 425
NdeII GATC 2 cut(s) 313, 403
NlaIV GGNNCC 2 cut(s) 82, 120
NmuCI GTSAC 1 cut(s) 48
PasI CCCWGGG 1 cut(s) 424
PceI AGGCCT 1 cut(s) 396
PctI GAATGC 1 cut(s) 433
PfeI GAWTC 4 cut(s) 8, 16, 40, 230
PflFI GACNNNGTC 1 cut(s) 335
PkrI GCNGC 1 cut(s) 225
Psp6I CCWGG 1 cut(s) 423
PspFI CCCAGC 1 cut(s) 140
PspGI CCWGG 1 cut(s) 423
PspN4I GGNNCC 2 cut(s) 82, 120
PspPI GGNCC 2 cut(s) 80, 190
PsuI RGATCY 1 cut(s) 313
PsyI GACNNNGTC 1 cut(s) 335
RsaI GTAC 2 cut(s) 96, 275
RsaNI GTAC 2 cut(s) 95, 274
SatI GCNGC 1 cut(s) 224
Sau3AI GATC 2 cut(s) 313, 403
Sau96I GGNCC 2 cut(s) 80, 190
ScaI AGTACT 1 cut(s) 275
ScrFI CCNGG 1 cut(s) 425
SduI GDGCHC 1 cut(s) 121
SetI ASST 8 cut(s) 96, 142, 209, 264, 299, 327, 339, 381
SinI GGWCC 1 cut(s) 190
SmlI CTYRAG 2 cut(s) 269, 347
SmoI CTYRAG 2 cut(s) 269, 347
Sse9I AATT 2 cut(s) 32, 217
SseBI AGGCCT 1 cut(s) 396
SspMI CTAG 1 cut(s) 442
StuI AGGCCT 1 cut(s) 396
StyD4I CCNGG 1 cut(s) 423
TaaI ACNGT 1 cut(s) 257
TaqI TCGA 1 cut(s) 38
TasI AATT 2 cut(s) 32, 217
TatI WGTACW 1 cut(s) 273
TfiI GAWTC 4 cut(s) 8, 16, 40, 230
TscAI CASTG 1 cut(s) 309
TseFI GTSAC 1 cut(s) 48
TseI GCWGC 1 cut(s) 223
Tsp45I GTSAC 1 cut(s) 48
TspDTI ATGAA 3 cut(s) 45, 222, 426
TspGWI ACGGA 1 cut(s) 67
TspRI CASTG 1 cut(s) 309
Tth111I GACNNNGTC 1 cut(s) 335
VpaK11BI GGWCC 1 cut(s) 190
XagI CCTNNNNNAGG 1 cut(s) 350
XapI RAATTY 2 cut(s) 32, 217
XspI CTAG 1 cut(s) 442
ZrmI AGTACT 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.