Rh2CG421700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
57626742 .. 57631223
4482 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG421700.1

Sequence Viewer

Length: 258 bp
ATGTGGTGGCTCACTATAGCATTTGCACAGGTTTACAATAGAGGAAACCAGGGATTGCAGAAGTGCTTGTGGGAGGCCAAGCGGTGTTTGAGATTAAGGTGGAGGAATGGGAGCAGTAAAGTCCTAAACCATTTAGAACGTGAATACCTTCTGGAAGATTTGAACAATTACAGGATTTTGAAAATTAACAAGCACTCTGCTGCACTCCTCAATGGAAGACAAAGTCAGTTTGGTCGGTACAGCAAAGTTGAATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

10.18

Weight (kDa)

10.17

Isoelectric Point (pI)

44.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AfaI GTAC 1 cut(s) 239
AgsI TTSAA 3 cut(s) 163, 181, 251
AjnI CCWGG 1 cut(s) 48
AoxI GGCC 1 cut(s) 75
ApeKI GCWGC 1 cut(s) 200
Asp700I GAANNNNTTC 1 cut(s) 147
BbsI GAAGAC 1 cut(s) 223
BbvI GCAGC 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 50
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 201
BlsI GCNGC 1 cut(s) 202
Bme1390I CCNGG 1 cut(s) 50
BmrFI CCNGG 1 cut(s) 50
BpiI GAAGAC 1 cut(s) 223
BsaJI CCNNGG 1 cut(s) 49
BseBI CCWGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 49
BseRI GAGGAG 1 cut(s) 197
BseXI GCAGC 1 cut(s) 187
BsgI GTGCAG 1 cut(s) 186
BshFI GGCC 1 cut(s) 77
BsnI GGCC 1 cut(s) 77
BspACI CCGC 1 cut(s) 82
BspANI GGCC 1 cut(s) 77
BspHI TCATGA 1 cut(s) 254
BssECI CCNNGG 1 cut(s) 49
Bst2UI CCWGG 1 cut(s) 50
BstNI CCWGG 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 48
BstSFI CTRYAG 1 cut(s) 15
BstV1I GCAGC 1 cut(s) 187
BstV2I GAAGAC 1 cut(s) 223
BsuRI GGCC 1 cut(s) 77
CciI TCATGA 1 cut(s) 254
Csp6I GTAC 1 cut(s) 238
CviAII CATG 1 cut(s) 255
CviJI RGCY 2 cut(s) 10, 77
CviKI_1 RGCY 2 cut(s) 10, 77
CviQI GTAC 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 258
FaiI YATR 2 cut(s) 17, 256
FatI CATG 1 cut(s) 254
Fnu4HI GCNGC 1 cut(s) 201
Fsp4HI GCNGC 1 cut(s) 201
GluI GCNGC 1 cut(s) 201
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 1 cut(s) 258
HinfI GANTC 1 cut(s) 251
Hpy166II GTNNAC 1 cut(s) 34
Hpy188III TCNNGA 2 cut(s) 152, 255
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 158
HpyCH4IV ACGT 1 cut(s) 139
HpyCH4V TGCA 3 cut(s) 26, 58, 203
HpySE526I ACGT 1 cut(s) 139
Hsp92II CATG 1 cut(s) 258
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 5 cut(s) 14, 35, 62, 137, 157
Lsp1109I GCAGC 1 cut(s) 187
MaeII ACGT 1 cut(s) 139
MboII GAAGA 2 cut(s) 167, 228
MluCI AATT 2 cut(s) 166, 183
MnlI CCTC 4 cut(s) 35, 67, 96, 218
MroXI GAANNNNTTC 1 cut(s) 147
MseI TTAA 2 cut(s) 95, 186
MspR9I CCNGG 1 cut(s) 50
MvaI CCWGG 1 cut(s) 50
NlaIII CATG 1 cut(s) 258
PagI TCATGA 1 cut(s) 254
PdmI GAANNNNTTC 1 cut(s) 147
PfeI GAWTC 1 cut(s) 251
PflFI GACNNNGTC 1 cut(s) 222
PkrI GCNGC 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 48
PspGI CCWGG 1 cut(s) 48
PsyI GACNNNGTC 1 cut(s) 222
RsaI GTAC 1 cut(s) 239
RsaNI GTAC 1 cut(s) 238
SaqAI TTAA 2 cut(s) 95, 186
SatI GCNGC 1 cut(s) 201
ScrFI CCNGG 1 cut(s) 50
SetI ASST 4 cut(s) 33, 101, 142, 150
SfcI CTRYAG 1 cut(s) 15
SgeI CNNG 9 cut(s) 41, 61, 62, 79, 91, 152, 164, 184, 202
Sse9I AATT 2 cut(s) 166, 183
SsiI CCGC 1 cut(s) 82
StyD4I CCNGG 1 cut(s) 48
TaiI ACGT 1 cut(s) 142
TasI AATT 2 cut(s) 166, 183
TfiI GAWTC 1 cut(s) 251
Tru1I TTAA 2 cut(s) 95, 186
Tru9I TTAA 2 cut(s) 95, 186
TseI GCWGC 1 cut(s) 200
Tth111I GACNNNGTC 1 cut(s) 222
XmnI GAANNNNTTC 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.