Rh3AG038000

Mitochondrial import inner membrane translocase subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
2552428 .. 2556194
3767 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG038000.1

Sequence Viewer

Length: 180 bp
ATGGCCGATTCAACCAAACCCACCACCGCCGTCGCCACCGCGAAGCCCTACAACCCCTACCAAGACCTCGACGCTCCGATCAAGAGGCTCTACTACCTCCCAACCTCGCCGGAGCACCTCTATCCCGAAAAAGCTCCAAAACCCTACCGTCCCTTTGGAGACAACCTCTTCATAATATGA

Protein Analysis

59

Amino Acids

6.73

Weight (kDa)

7.98

Isoelectric Point (pI)

46.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 41
AciI CCGC 2 cut(s) 27, 39
AcoI YGGCCR 1 cut(s) 3
AgsI TTSAA 1 cut(s) 12
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
Alw21I GWGCWC 1 cut(s) 117
Alw26I GTCTC 1 cut(s) 153
AoxI GGCC 1 cut(s) 3
Bbv12I GWGCWC 1 cut(s) 117
BceAI ACGGC 1 cut(s) 14
BcoDI GTCTC 1 cut(s) 153
BplI GAGNNNNNCTC 1 cut(s) 150
Bsh1236I CGCG 1 cut(s) 41
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 117
BsiSI CCGG 1 cut(s) 110
BslFI GGGAC 1 cut(s) 135
BsmAI GTCTC 1 cut(s) 153
BsmFI GGGAC 1 cut(s) 135
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 2 cut(s) 27, 39
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 41
BssMI GATC 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 173
BstFNI CGCG 1 cut(s) 41
BstKTI GATC 1 cut(s) 81
BstMAI GTCTC 1 cut(s) 153
BstMBI GATC 1 cut(s) 78
BstUI CGCG 1 cut(s) 41
BsuRI GGCC 1 cut(s) 5
CseI GACGC 1 cut(s) 80
CviJI RGCY 4 cut(s) 5, 46, 88, 134
CviKI_1 RGCY 4 cut(s) 5, 46, 88, 134
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
FaiI YATR 2 cut(s) 173, 178
FaqI GGGAC 1 cut(s) 135
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 110
HgaI GACGC 1 cut(s) 80
HinfI GANTC 1 cut(s) 8
HpaII CCGG 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 2 cut(s) 82, 125
Hpy99I CGWCG 2 cut(s) 35, 74
HpyCH4III ACNGT 1 cut(s) 149
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 3 cut(s) 79, 112, 139
LpnPI CCDG 1 cut(s) 123
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 1 cut(s) 160
MhlI GDGCHC 1 cut(s) 117
MnlI CCTC 6 cut(s) 77, 78, 107, 115, 128, 176
MspI CCGG 1 cut(s) 110
MvnI CGCG 1 cut(s) 41
NdeII GATC 1 cut(s) 78
PfeI GAWTC 1 cut(s) 8
Sau3AI GATC 1 cut(s) 78
SduI GDGCHC 1 cut(s) 117
SetI ASST 6 cut(s) 69, 99, 107, 120, 136, 168
SgeI CNNG 7 cut(s) 52, 74, 80, 94, 118, 122, 137
SsiI CCGC 2 cut(s) 27, 39
TaaI ACNGT 1 cut(s) 149
TaqI TCGA 1 cut(s) 69
TfiI GAWTC 1 cut(s) 8
TspDTI ATGAA 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.