Rh3CG287700

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
29105533 .. 29107692
2160 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG287700.1

Sequence Viewer

Length: 222 bp
ATGAATTTCCTGCAACGAAGGTACTATGACTTGAAGGTTGGGAATGGAACTGAGGCAGTCCATTATGTTGCAAAGTGGAAGGGTATCACTTTCATGACAAGTAGACAAGGACTTGGTGTTGGTGGAGGAACTTGTAATGTGCATGTATATGGAAGCAAAGGAGTCCAAGAAATCCCTCCAAATGCAACAATAGAGGGCATATTTTATTCCCAATGGAGCTGA

Protein Analysis

73

Amino Acids

8.12

Weight (kDa)

9.25

Isoelectric Point (pI)

46.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 103
AcsI RAATTY 1 cut(s) 4
AfaI GTAC 1 cut(s) 23
AgsI TTSAA 1 cut(s) 34
AluBI AGCT 1 cut(s) 219
AluI AGCT 1 cut(s) 219
ApoI RAATTY 1 cut(s) 4
BseMII CTCAG 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 43
BspHI TCATGA 1 cut(s) 93
BstDEI CTNAG 1 cut(s) 51
BstNSI RCATGY 1 cut(s) 146
CciI TCATGA 1 cut(s) 93
Csp6I GTAC 1 cut(s) 22
CviAII CATG 2 cut(s) 94, 143
CviJI RGCY 1 cut(s) 219
CviKI_1 RGCY 1 cut(s) 219
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 1 cut(s) 51
FaeI CATG 2 cut(s) 97, 146
FaiI YATR 7 cut(s) 27, 66, 95, 144, 148, 150, 200
FatI CATG 2 cut(s) 93, 142
FblI GTMKAC 1 cut(s) 103
Hin1II CATG 2 cut(s) 97, 146
HinfI GANTC 1 cut(s) 162
Hpy166II GTNNAC 1 cut(s) 104
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 104
HpyAV CCTTC 3 cut(s) 12, 28, 73
HpyCH4V TGCA 4 cut(s) 13, 71, 142, 185
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 2 cut(s) 97, 146
LmnI GCTCC 1 cut(s) 216
LpnPI CCDG 1 cut(s) 23
MluCI AATT 1 cut(s) 4
MlyI GAGTC 1 cut(s) 171
MnlI CCTC 4 cut(s) 46, 119, 186, 187
MslI CAYNNNNRTG 2 cut(s) 92, 147
NlaIII CATG 2 cut(s) 97, 146
NspI RCATGY 1 cut(s) 146
PagI TCATGA 1 cut(s) 93
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
RseI CAYNNNNRTG 2 cut(s) 92, 147
SchI GAGTC 1 cut(s) 171
SetI ASST 3 cut(s) 23, 39, 221
SgeI CNNG 9 cut(s) 22, 43, 106, 111, 119, 125, 144, 155, 179
SmiMI CAYNNNNRTG 2 cut(s) 92, 147
Sse9I AATT 1 cut(s) 4
TasI AATT 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 17, 82
XapI RAATTY 1 cut(s) 4
XceI RCATGY 1 cut(s) 146
XmiI GTMKAC 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.