Rh4DG183900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
36455995 .. 36456634
640 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG183900.1

Sequence Viewer

Length: 309 bp
ATGCGTGTGAAACCTTATCTGCATATTATCTTCATTCCACAGTCTCCCCGAGTTTCTGATCTCTCTCTATTCTCTGCATCTCCCTCTTTCTCCCAGATCTATAGCACAGATGATTCATTATGCAAGACACCGAACCTATCGTTGAGGAGATGGCCTATCATCAAACATATCGACACCATCGACCGCGACAAACAGATCGAGATTCACAAAGAGATGAATTCTGAAACTAGATCCTGTTTACAACAGTACTTGTGTATGATTTACTGCAATAACATCCCAGATTTGCAAGATCTCAATGAAGAACGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

12.04

Weight (kDa)

6.26

Isoelectric Point (pI)

87.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 186
AciI CCGC 1 cut(s) 184
AclWI GGATC 1 cut(s) 225
AcsI RAATTY 1 cut(s) 217
AfaI GTAC 1 cut(s) 248
Alw26I GTCTC 1 cut(s) 48
AlwI GGATC 1 cut(s) 225
Ama87I CYCGRG 1 cut(s) 48
AoxI GGCC 1 cut(s) 152
ApoI RAATTY 1 cut(s) 217
AvaI CYCGRG 1 cut(s) 48
BccI CCATC 2 cut(s) 144, 185
BcoDI GTCTC 1 cut(s) 48
BfaI CTAG 1 cut(s) 228
BfmI CTRYAG 1 cut(s) 100
BglII AGATCT 2 cut(s) 96, 289
BmcAI AGTACT 1 cut(s) 248
BmeT110I CYCGRG 1 cut(s) 48
BmsI GCATC 1 cut(s) 86
BseGI GGATG 1 cut(s) 273
BseRI GAGGAG 1 cut(s) 160
Bsh1236I CGCG 1 cut(s) 186
Bsh1285I CGRYCG 1 cut(s) 184
BshFI GGCC 1 cut(s) 154
BsiEI CGRYCG 1 cut(s) 184
BsiHKCI CYCGRG 1 cut(s) 48
BsmAI GTCTC 1 cut(s) 48
BsnI GGCC 1 cut(s) 154
BsoBI CYCGRG 1 cut(s) 48
Bsp143I GATC 5 cut(s) 58, 96, 195, 230, 289
BspACI CCGC 1 cut(s) 184
BspANI GGCC 1 cut(s) 154
BspFNI CGCG 1 cut(s) 186
BspPI GGATC 1 cut(s) 225
BssMI GATC 5 cut(s) 58, 96, 195, 230, 289
Bst4CI ACNGT 2 cut(s) 42, 246
BstF5I GGATG 1 cut(s) 273
BstFNI CGCG 1 cut(s) 186
BstKTI GATC 5 cut(s) 61, 99, 198, 233, 292
BstMAI GTCTC 1 cut(s) 48
BstMBI GATC 5 cut(s) 58, 96, 195, 230, 289
BstMCI CGRYCG 1 cut(s) 184
BstSFI CTRYAG 1 cut(s) 100
BstUI CGCG 1 cut(s) 186
BstX2I RGATCY 3 cut(s) 96, 230, 289
BstYI RGATCY 3 cut(s) 96, 230, 289
BsuRI GGCC 1 cut(s) 154
BtsCI GGATG 1 cut(s) 273
Csp6I GTAC 1 cut(s) 247
CviJI RGCY 1 cut(s) 154
CviKI_1 RGCY 1 cut(s) 154
CviQI GTAC 1 cut(s) 247
DpnI GATC 5 cut(s) 60, 98, 197, 232, 291
DpnII GATC 5 cut(s) 58, 96, 195, 230, 289
Eco88I CYCGRG 1 cut(s) 48
EcoRI GAATTC 1 cut(s) 217
FaiI YATR 5 cut(s) 24, 102, 121, 168, 257
FokI GGATG 1 cut(s) 260
FspBI CTAG 1 cut(s) 228
HaeIII GGCC 1 cut(s) 154
HinfI GANTC 2 cut(s) 113, 202
Hpy166II GTNNAC 1 cut(s) 239
Hpy188I TCNGA 2 cut(s) 58, 223
Hpy188III TCNNGA 1 cut(s) 199
Hpy8I GTNNAC 1 cut(s) 239
HpyCH4III ACNGT 2 cut(s) 42, 246
HpyCH4V TGCA 5 cut(s) 22, 77, 123, 267, 286
Kzo9I GATC 5 cut(s) 58, 96, 195, 230, 289
LpnPI CCDG 3 cut(s) 107, 247, 291
LweI GCATC 1 cut(s) 86
MaeI CTAG 1 cut(s) 228
MalI GATC 5 cut(s) 60, 98, 197, 232, 291
MboI GATC 5 cut(s) 58, 96, 195, 230, 289
MboII GAAGA 1 cut(s) 22
MflI RGATCY 3 cut(s) 96, 230, 289
MluCI AATT 1 cut(s) 217
MnlI CCTC 2 cut(s) 94, 138
MvnI CGCG 1 cut(s) 186
NdeII GATC 5 cut(s) 58, 96, 195, 230, 289
PcsI WCGNNNNNNNCGW 1 cut(s) 177
PfeI GAWTC 2 cut(s) 113, 202
PsuI RGATCY 3 cut(s) 96, 230, 289
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
Sau3AI GATC 5 cut(s) 58, 96, 195, 230, 289
ScaI AGTACT 1 cut(s) 248
SetI ASST 2 cut(s) 16, 138
SfaNI GCATC 1 cut(s) 86
SfcI CTRYAG 1 cut(s) 100
Sse9I AATT 1 cut(s) 217
SsiI CCGC 1 cut(s) 184
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 2 cut(s) 42, 246
TaqI TCGA 3 cut(s) 171, 180, 198
TasI AATT 1 cut(s) 217
TatI WGTACW 1 cut(s) 246
TfiI GAWTC 2 cut(s) 113, 202
TspDTI ATGAA 3 cut(s) 22, 105, 230
XapI RAATTY 1 cut(s) 217
XspI CTAG 1 cut(s) 228
ZrmI AGTACT 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.