Rh5AG191700

Belongs to the small heat shock protein (HSP20) family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
22134421 .. 22135516
1096 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG191700.1

Sequence Viewer

Length: 189 bp
ATGAAGAAGGTGGACCTCCCCGGATTTAAGAATGAAGAAGTAAAGGTTGAGCTGGAGGAAGGGAATGTCCTTCAGATCAGTGGAGAGAGAAGCAATGAGCAAGAGGAGAAGAATGACAAGTGCCACAGCTACGTCGTCGCCTTCGCCTCACCAGAGCCTCGAGTTCACCATCAAGTCACTCTAAGGTAG
Functional Annotation

Protein Analysis

62

Amino Acids

7.13

Weight (kDa)

5.54

Isoelectric Point (pI)

52.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP20 PF00011 3 - 41 5.9e-07 Hsp20/alpha crystallin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 56
AluBI AGCT 2 cut(s) 52, 129
AluI AGCT 2 cut(s) 52, 129
Ama87I CYCGRG 1 cut(s) 159
AspS9I GGNCC 1 cut(s) 13
AsuC2I CCSGG 1 cut(s) 21
AsuHPI GGTGA 2 cut(s) 141, 158
AvaI CYCGRG 1 cut(s) 159
AvaII GGWCC 1 cut(s) 13
BccI CCATC 1 cut(s) 177
BcnI CCSGG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 13
BmeT110I CYCGRG 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 13
BmrFI CCNGG 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 74
BpuMI CCSGG 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 19
Bse3DI GCAATG 1 cut(s) 100
BseDI CCNNGG 1 cut(s) 19
BseMI GCAATG 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 119
BsiHKCI CYCGRG 1 cut(s) 159
BsiSI CCGG 1 cut(s) 21
BsoBI CYCGRG 1 cut(s) 159
Bsp143I GATC 1 cut(s) 75
BsrDI GCAATG 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 19
BssMI GATC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 182
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 85
Cfr13I GGNCC 1 cut(s) 13
CviJI RGCY 3 cut(s) 52, 129, 157
CviKI_1 RGCY 3 cut(s) 52, 129, 157
DdeI CTNAG 1 cut(s) 182
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 13
Eco57I CTGAAG 1 cut(s) 56
Eco88I CYCGRG 1 cut(s) 159
GsuI CTGGAG 1 cut(s) 74
HapII CCGG 1 cut(s) 21
HpaII CCGG 1 cut(s) 21
HphI GGTGA 2 cut(s) 141, 158
Hpy166II GTNNAC 2 cut(s) 13, 166
Hpy188I TCNGA 1 cut(s) 75
Hpy8I GTNNAC 2 cut(s) 13, 166
Hpy99I CGWCG 2 cut(s) 137, 140
HpyAV CCTTC 3 cut(s) 53, 80, 151
HpyCH4IV ACGT 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 182
HpySE526I ACGT 1 cut(s) 132
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 3 cut(s) 34, 38, 165
MaeII ACGT 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 175
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 3 cut(s) 16, 47, 121
MnlI CCTC 5 cut(s) 26, 49, 97, 157, 168
MseI TTAA 1 cut(s) 27
MspI CCGG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 21
NciI CCSGG 1 cut(s) 21
NdeII GATC 1 cut(s) 75
NmuCI GTSAC 1 cut(s) 175
PaeR7I CTCGAG 1 cut(s) 159
PspPI GGNCC 1 cut(s) 13
PspXI VCTCGAGB 1 cut(s) 159
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 21
SetI ASST 7 cut(s) 12, 18, 48, 54, 131, 135, 188
Sfr274I CTCGAG 1 cut(s) 159
SgeI CNNG 9 cut(s) 32, 33, 65, 113, 130, 164, 171, 173, 185
SinI GGWCC 1 cut(s) 13
SlaI CTCGAG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
StyD4I CCNGG 1 cut(s) 19
TaiI ACGT 1 cut(s) 135
TaqI TCGA 1 cut(s) 160
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TscAI CASTG 1 cut(s) 85
TseFI GTSAC 1 cut(s) 175
Tsp45I GTSAC 1 cut(s) 175
TspDTI ATGAA 2 cut(s) 17, 48
TspRI CASTG 1 cut(s) 85
VpaK11BI GGWCC 1 cut(s) 13
XhoI CTCGAG 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.