Rh5AG332000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
52925471 .. 52979342
53872 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG332000.1

Sequence Viewer

Length: 174 bp
ATGGGCTACATGCACTTTGGCACAGTCAAGATATATGGTTCTGAGGCTGCCCTTATAAACACTTTAACAGAGACAAAAAAAATTTATCAACATGTCATCGAAAACATAACAAGTAATTTTGATATATATACTCAAATATCACAATGTAAATCAATACGACAAATCGATATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.57

Weight (kDa)

6.7

Isoelectric Point (pI)

40.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 56
AcsI RAATTY 1 cut(s) 81
AflIII ACRYGT 1 cut(s) 91
Alw26I GTCTC 1 cut(s) 65
ApeKI GCWGC 1 cut(s) 47
ApoI RAATTY 1 cut(s) 81
BbvI GCAGC 1 cut(s) 34
BcoDI GTCTC 1 cut(s) 65
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
Bsa29I ATCGAT 1 cut(s) 165
BseCI ATCGAT 1 cut(s) 165
BseMII CTCAG 1 cut(s) 33
BseXI GCAGC 1 cut(s) 34
BshVI ATCGAT 1 cut(s) 165
BsmAI GTCTC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 34
BspDI ATCGAT 1 cut(s) 165
Bst4CI ACNGT 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 42
BstMAI GTCTC 1 cut(s) 65
BstNSI RCATGY 2 cut(s) 13, 95
BstV1I GCAGC 1 cut(s) 34
Bsu15I ATCGAT 1 cut(s) 165
BsuTUI ATCGAT 1 cut(s) 165
ClaI ATCGAT 1 cut(s) 165
CviAII CATG 2 cut(s) 10, 92
CviJI RGCY 2 cut(s) 6, 47
CviKI_1 RGCY 2 cut(s) 6, 47
DdeI CTNAG 1 cut(s) 42
FaeI CATG 2 cut(s) 13, 95
FaiI YATR 9 cut(s) 11, 34, 36, 56, 93, 107, 125, 127, 129
FatI CATG 2 cut(s) 9, 91
Fnu4HI GCNGC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 48
FspEI CC 5 cut(s) 3, 21, 29, 64, 65
GluI GCNGC 1 cut(s) 48
Hin1II CATG 2 cut(s) 13, 95
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 25
HpyCH4V TGCA 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 2 cut(s) 13, 95
Lsp1109I GCAGC 1 cut(s) 34
MluCI AATT 2 cut(s) 81, 115
MnlI CCTC 1 cut(s) 37
MseI TTAA 2 cut(s) 65, 172
NlaIII CATG 2 cut(s) 13, 95
NspI RCATGY 2 cut(s) 13, 95
PciI ACATGT 1 cut(s) 91
PkrI GCNGC 1 cut(s) 49
PscI ACATGT 1 cut(s) 91
PsiI TTATAA 1 cut(s) 56
SaqAI TTAA 2 cut(s) 65, 172
SatI GCNGC 1 cut(s) 48
SgeI CNNG 4 cut(s) 22, 40, 104, 123
Sse9I AATT 2 cut(s) 81, 115
TaaI ACNGT 1 cut(s) 25
TaqI TCGA 2 cut(s) 99, 165
TasI AATT 2 cut(s) 81, 115
Tru1I TTAA 2 cut(s) 65, 172
Tru9I TTAA 2 cut(s) 65, 172
TseI GCWGC 1 cut(s) 47
XapI RAATTY 1 cut(s) 81
XceI RCATGY 2 cut(s) 13, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.