Rh5AG444300
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. mRNA cap 0 methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0017399
Physical Location & Seq
Reverse (-)
76184393 .. 76185489
1097 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG444300.1

Sequence Viewer

Length: 327 bp
ATGTTAATTGAGGATTCAAATTTCTTGGAGGATGAAAGCACAAAGATATTTGCACGTAAAGTGGCCGATCATTATAGTGCAAGGACAAATCAAACTCTGGAAGAACGAGAAGCTAGTCCGATCATCCATTTAAAAAAGCTTAACAACTGGATTAAGAGTGTACTAATTCAGCTCTATGCTCGCCGAGGAGATGCTGTTCTTGATCTTGCATGCGGAAAGGGAGGTGATCTCATCAAATGGGACAAGGCCAAAATTGGGTACTATGTTGGCATTGATATCACTCAAAAACTGCATCACACGACGGTGAAAAAACGTCGTCTGATTTGA

Protein Analysis

108

Amino Acids

12.44

Weight (kDa)

9.41

Isoelectric Point (pI)

36.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
mRNA_G-N7_MeTrfase PF03291 10 - 95 9.4e-34 mRNA (guanine-N(7))-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 213
AcoI YGGCCR 1 cut(s) 63
AcsI RAATTY 1 cut(s) 19
AfaI GTAC 2 cut(s) 162, 260
AfiI CCNNNNNNNGG 1 cut(s) 255
AgsI TTSAA 1 cut(s) 18
AleI CACNNNNGTG 1 cut(s) 302
AloI GAACNNNNNNTCC 2 cut(s) 180, 212
AluBI AGCT 3 cut(s) 113, 139, 172
AluI AGCT 3 cut(s) 113, 139, 172
AoxI GGCC 2 cut(s) 63, 246
ApoI RAATTY 1 cut(s) 19
AsuHPI GGTGA 2 cut(s) 236, 316
BfaI CTAG 1 cut(s) 114
BmsI GCATC 2 cut(s) 181, 301
BplI GAGNNNNNCTC 2 cut(s) 213, 245
BsaAI YACGTR 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 184
BsaXI ACNNNNNCTCC 2 cut(s) 180, 210
Bsc4I CCNNNNNNNGG 1 cut(s) 255
Bse1I ACTGG 1 cut(s) 152
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 2 cut(s) 37, 123
BseLI CCNNNNNNNGG 1 cut(s) 255
BseNI ACTGG 1 cut(s) 152
BseRI GAGGAG 1 cut(s) 201
BshFI GGCC 2 cut(s) 65, 248
BslFI GGGAC 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 255
BsmFI GGGAC 1 cut(s) 254
BsnI GGCC 2 cut(s) 65, 248
Bsp143I GATC 4 cut(s) 67, 120, 202, 226
BspACI CCGC 1 cut(s) 213
BspANI GGCC 2 cut(s) 65, 248
BsrI ACTGG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 4 cut(s) 67, 120, 202, 226
Bst4CI ACNGT 1 cut(s) 304
BstBAI YACGTR 1 cut(s) 56
BstC8I GCNNGC 2 cut(s) 181, 211
BstF5I GGATG 2 cut(s) 37, 123
BstKTI GATC 4 cut(s) 70, 123, 205, 229
BstMBI GATC 4 cut(s) 67, 120, 202, 226
BstNSI RCATGY 1 cut(s) 213
BsuRI GGCC 2 cut(s) 65, 248
BtsCI GGATG 2 cut(s) 37, 123
Cac8I GCNNGC 2 cut(s) 181, 211
Csp6I GTAC 2 cut(s) 161, 259
CviAII CATG 1 cut(s) 210
CviJI RGCY 5 cut(s) 65, 113, 139, 172, 248
CviKI_1 RGCY 5 cut(s) 65, 113, 139, 172, 248
CviQI GTAC 2 cut(s) 161, 259
DpnI GATC 4 cut(s) 69, 122, 204, 228
DpnII GATC 4 cut(s) 67, 120, 202, 226
DraI TTTAAA 1 cut(s) 132
EaeI YGGCCR 1 cut(s) 63
Eco32I GATATC 1 cut(s) 277
EcoRV GATATC 1 cut(s) 277
FaeI CATG 1 cut(s) 213
FaiI YATR 4 cut(s) 75, 177, 211, 264
FaqI GGGAC 1 cut(s) 254
FatI CATG 1 cut(s) 209
FokI GGATG 2 cut(s) 44, 110
FspBI CTAG 1 cut(s) 114
HaeIII GGCC 2 cut(s) 65, 248
Hin1II CATG 1 cut(s) 213
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 1 cut(s) 14
HphI GGTGA 2 cut(s) 236, 316
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 2 cut(s) 120, 321
Hpy188III TCNNGA 2 cut(s) 98, 200
Hpy8I GTNNAC 1 cut(s) 161
Hpy99I CGWCG 2 cut(s) 304, 318
HpyCH4III ACNGT 1 cut(s) 304
HpyCH4IV ACGT 2 cut(s) 55, 313
HpyCH4V TGCA 4 cut(s) 53, 80, 209, 292
HpySE526I ACGT 2 cut(s) 55, 313
Hsp92II CATG 1 cut(s) 213
Kzo9I GATC 4 cut(s) 67, 120, 202, 226
LpnPI CCDG 2 cut(s) 83, 133
LweI GCATC 2 cut(s) 181, 301
MaeI CTAG 1 cut(s) 114
MaeII ACGT 2 cut(s) 55, 313
MalI GATC 4 cut(s) 69, 122, 204, 228
MboI GATC 4 cut(s) 67, 120, 202, 226
MboII GAAGA 1 cut(s) 113
MluCI AATT 4 cut(s) 6, 19, 165, 252
MnlI CCTC 4 cut(s) 4, 22, 179, 215
MseI TTAA 4 cut(s) 5, 131, 141, 153
MslI CAYNNNNRTG 2 cut(s) 75, 302
NdeII GATC 4 cut(s) 67, 120, 202, 226
NlaIII CATG 1 cut(s) 213
NmeAIII GCCGAG 1 cut(s) 209
NspI RCATGY 1 cut(s) 213
OliI CACNNNNGTG 1 cut(s) 302
PaeI GCATGC 1 cut(s) 213
PfeI GAWTC 1 cut(s) 14
Ppu21I YACGTR 1 cut(s) 56
RsaI GTAC 2 cut(s) 162, 260
RsaNI GTAC 2 cut(s) 161, 259
RseI CAYNNNNRTG 2 cut(s) 75, 302
SaqAI TTAA 4 cut(s) 5, 131, 141, 153
Sau3AI GATC 4 cut(s) 67, 120, 202, 226
SetI ASST 6 cut(s) 58, 115, 141, 174, 226, 316
SfaNI GCATC 2 cut(s) 181, 301
SmiMI CAYNNNNRTG 2 cut(s) 75, 302
SphI GCATGC 1 cut(s) 213
Sse9I AATT 4 cut(s) 6, 19, 165, 252
SsiI CCGC 1 cut(s) 213
SspMI CTAG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 304
TaiI ACGT 2 cut(s) 58, 316
TasI AATT 4 cut(s) 6, 19, 165, 252
TatI WGTACW 1 cut(s) 160
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 4 cut(s) 5, 131, 141, 153
Tru9I TTAA 4 cut(s) 5, 131, 141, 153
TspDTI ATGAA 1 cut(s) 48
XapI RAATTY 1 cut(s) 19
XceI RCATGY 1 cut(s) 213
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.