Rh5BG462800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0017467
Physical Location & Seq
Reverse (-)
73981617 .. 73981787
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG462800.1

Sequence Viewer

Length: 171 bp
ATGGGCGGCGTCGTTGGTGGTGGTATCACTGTCGGGGATGATGGTAATGGTTGGTGGCAGAAGAGTGTTTGGATCTCTCGAGATCAGATTTTGTTTGGACAGATTTATTTTCTTGACTGGAGTGGTGGTCCTAATCTCGGAGGCAGGTTTTGTGGTGAGTGCGACGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.02

Weight (kDa)

4.16

Isoelectric Point (pI)

31.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 135
AciI CCGC 1 cut(s) 6
AclWI GGATC 1 cut(s) 80
AcyI GRCGYC 1 cut(s) 9
AfiI CCNNNNNNNGG 1 cut(s) 137
AlwI GGATC 1 cut(s) 80
Ama87I CYCGRG 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 167
AvaI CYCGRG 1 cut(s) 78
AvaII GGWCC 1 cut(s) 128
BccI CCATC 1 cut(s) 35
BfuAI ACCTGC 1 cut(s) 135
BisI GCNGC 1 cut(s) 7
BlsI GCNGC 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 128
BmeT110I CYCGRG 1 cut(s) 78
BmgT120I GGNCC 1 cut(s) 128
BpmI CTGGAG 1 cut(s) 139
BsaHI GRCGYC 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
Bsc4I CCNNNNNNNGG 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 122
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 122
BsiHKCI CYCGRG 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 137
BsoBI CYCGRG 1 cut(s) 78
Bsp143I GATC 2 cut(s) 72, 82
BspACI CCGC 1 cut(s) 6
BspMI ACCTGC 1 cut(s) 135
BspPI GGATC 1 cut(s) 80
BsrI ACTGG 1 cut(s) 122
BssMI GATC 2 cut(s) 72, 82
BssNI GRCGYC 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 31
Bst6I CTCTTC 1 cut(s) 56
BstACI GRCGYC 1 cut(s) 9
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 2 cut(s) 75, 85
BstMBI GATC 2 cut(s) 72, 82
BstX2I RGATCY 1 cut(s) 72
BstYI RGATCY 1 cut(s) 72
BtsCI GGATG 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 27
BveI ACCTGC 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 128
DpnI GATC 2 cut(s) 74, 84
DpnII GATC 2 cut(s) 72, 82
Eam1104I CTCTTC 1 cut(s) 56
EarI CTCTTC 1 cut(s) 56
Eco47I GGWCC 1 cut(s) 128
Eco88I CYCGRG 1 cut(s) 78
Fnu4HI GCNGC 1 cut(s) 7
FokI GGATG 1 cut(s) 50
Fsp4HI GCNGC 1 cut(s) 7
GluI GCNGC 1 cut(s) 7
GsuI CTGGAG 1 cut(s) 139
Hin1I GRCGYC 1 cut(s) 9
HphI GGTGA 1 cut(s) 167
Hpy188I TCNGA 2 cut(s) 87, 140
Hpy188III TCNNGA 3 cut(s) 78, 80, 113
Hpy99I CGWCG 2 cut(s) 14, 167
HpyCH4III ACNGT 1 cut(s) 31
Hsp92I GRCGYC 1 cut(s) 9
Kzo9I GATC 2 cut(s) 72, 82
LpnPI CCDG 2 cut(s) 103, 130
MalI GATC 2 cut(s) 74, 84
MboI GATC 2 cut(s) 72, 82
MboII GAAGA 1 cut(s) 73
MflI RGATCY 1 cut(s) 72
MnlI CCTC 1 cut(s) 134
NdeII GATC 2 cut(s) 72, 82
PaeR7I CTCGAG 1 cut(s) 78
PkrI GCNGC 1 cut(s) 8
PspPI GGNCC 1 cut(s) 128
PsuI RGATCY 1 cut(s) 72
SatI GCNGC 1 cut(s) 7
Sau3AI GATC 2 cut(s) 72, 82
Sau96I GGNCC 1 cut(s) 128
SetI ASST 1 cut(s) 149
Sfr274I CTCGAG 1 cut(s) 78
SgeI CNNG 7 cut(s) 46, 90, 92, 125, 130, 149, 157
SinI GGWCC 1 cut(s) 128
SlaI CTCGAG 1 cut(s) 78
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
SsiI CCGC 1 cut(s) 6
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 79
TauI GCSGC 1 cut(s) 9
TscAI CASTG 1 cut(s) 34
TspRI CASTG 1 cut(s) 34
VpaK11BI GGWCC 1 cut(s) 128
XhoI CTCGAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.