Rh5DG492500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0014413
Physical Location & Seq
Forward (+)
77380038 .. 77380319
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG492500.1

Sequence Viewer

Length: 282 bp
ATGCGTCCTCATGAGTCCAACAAATCCGACGACTCCGCCTGGCCGCACCACCACAATCGGTCCGATCACGTCCACAACCACCAGCGCCATCATATTCGCTTCTACAGTACACCCCAGGTGGGGCCTACCTACGACGGAGGACCAGCCACTATCGGAGGCTCCTTCAAGAAGAGCAAGCCCAAGTTTTCGCTCCTGACTAGTCTATTCCGGTCCAGATCCAACAAGTTCTGGACAGATCCTAGGGTATCGTCGCGGGACTCGACTTCGAAGTCCGCAGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF740

Protein Analysis

93

Amino Acids

10.6

Weight (kDa)

10.48

Isoelectric Point (pI)

61.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014413)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G44600 AT3G60200
fragaria_vesca FvH4_7g08720
malus_domestica MD07G1088100.v1.1
prunus_persica Prupe.2G114900_v2.0.a1
pyrus_communis pycom02g19430 pycom07g07070
rosa_laevigata RLG00000028945 RLG00000030787
rosa_multiflora Rmu_ssc0000434.1_g000045
rosa_roxburghii Rroxscaffold_4G00310220
rosa_rugosa Rorug01G0169900
rosa_samantha Rh1BG152800 Rh1DG185200 Rh5DG492500 Rh6AG022200
rosa_wichuraiana Rw1G015380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 268
AccII CGCG 1 cut(s) 253
AciI CCGC 4 cut(s) 36, 44, 253, 273
AclWI GGATC 2 cut(s) 210, 230
AcoI YGGCCR 1 cut(s) 41
AfaI GTAC 1 cut(s) 109
AfiI CCNNNNNNNGG 2 cut(s) 119, 120
AgsI TTSAA 1 cut(s) 166
AhlI ACTAGT 1 cut(s) 197
AjiI CACGTC 1 cut(s) 70
AjnI CCWGG 2 cut(s) 38, 114
AlwI GGATC 2 cut(s) 210, 230
AoxI GGCC 2 cut(s) 41, 122
AspA2I CCTAGG 1 cut(s) 239
AspLEI GCGC 1 cut(s) 87
AspS9I GGNCC 4 cut(s) 60, 122, 140, 210
AsuII TTCGAA 1 cut(s) 266
AvaII GGWCC 3 cut(s) 60, 140, 210
AvrII CCTAGG 1 cut(s) 239
BccI CCATC 1 cut(s) 96
BciT130I CCWGG 2 cut(s) 40, 116
BcuI ACTAGT 1 cut(s) 197
BfaI CTAG 2 cut(s) 198, 240
BfmI CTRYAG 1 cut(s) 103
BfoI RGCGCY 1 cut(s) 88
BisI GCNGC 1 cut(s) 44
BlnI CCTAGG 1 cut(s) 239
BlsI GCNGC 1 cut(s) 45
Bme1390I CCNGG 2 cut(s) 40, 116
Bme18I GGWCC 3 cut(s) 60, 140, 210
BmgBI CACGTC 1 cut(s) 70
BmgT120I GGNCC 4 cut(s) 60, 122, 140, 210
BmiI GGNNCC 2 cut(s) 123, 160
BmrFI CCNGG 2 cut(s) 40, 116
Bpu14I TTCGAA 1 cut(s) 266
BsaJI CCNNGG 2 cut(s) 114, 239
BsaWI WCCGGW 1 cut(s) 207
Bsc4I CCNNNNNNNGG 2 cut(s) 119, 120
BseBI CCWGG 2 cut(s) 40, 116
BseDI CCNNGG 2 cut(s) 114, 239
BseLI CCNNNNNNNGG 2 cut(s) 119, 120
Bsh1236I CGCG 1 cut(s) 253
BshFI GGCC 2 cut(s) 43, 124
BsiSI CCGG 1 cut(s) 208
BslFI GGGAC 1 cut(s) 269
BslI CCNNNNNNNGG 2 cut(s) 119, 120
BsmFI GGGAC 1 cut(s) 269
BsnI GGCC 2 cut(s) 43, 124
Bsp119I TTCGAA 1 cut(s) 266
Bsp143I GATC 3 cut(s) 64, 215, 235
BspACI CCGC 4 cut(s) 36, 44, 253, 273
BspANI GGCC 2 cut(s) 43, 124
BspFNI CGCG 1 cut(s) 253
BspHI TCATGA 1 cut(s) 10
BspLI GGNNCC 2 cut(s) 123, 160
BspPI GGATC 2 cut(s) 210, 230
BspQI GCTCTTC 1 cut(s) 164
BspT104I TTCGAA 1 cut(s) 266
BssECI CCNNGG 2 cut(s) 114, 239
BssMI GATC 3 cut(s) 64, 215, 235
BssT1I CCWWGG 1 cut(s) 239
Bst2UI CCWGG 2 cut(s) 40, 116
Bst4CI ACNGT 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 164
BstBI TTCGAA 1 cut(s) 266
BstC8I GCNNGC 1 cut(s) 176
BstFNI CGCG 1 cut(s) 253
BstH2I RGCGCY 1 cut(s) 88
BstHHI GCGC 1 cut(s) 87
BstKTI GATC 3 cut(s) 67, 218, 238
BstMBI GATC 3 cut(s) 64, 215, 235
BstNI CCWGG 2 cut(s) 40, 116
BstSCI CCNGG 2 cut(s) 38, 114
BstSFI CTRYAG 1 cut(s) 103
BstUI CGCG 1 cut(s) 253
BstX2I RGATCY 2 cut(s) 215, 235
BstYI RGATCY 2 cut(s) 215, 235
BsuRI GGCC 2 cut(s) 43, 124
BtrI CACGTC 1 cut(s) 70
Cac8I GCNNGC 1 cut(s) 176
CciI TCATGA 1 cut(s) 10
CfoI GCGC 1 cut(s) 87
Cfr13I GGNCC 4 cut(s) 60, 122, 140, 210
CpoI CGGWCCG 1 cut(s) 60
Csp6I GTAC 1 cut(s) 108
CspI CGGWCCG 1 cut(s) 60
CviAII CATG 1 cut(s) 11
CviJI RGCY 5 cut(s) 43, 124, 146, 159, 178
CviKI_1 RGCY 5 cut(s) 43, 124, 146, 159, 178
CviQI GTAC 1 cut(s) 108
DpnI GATC 3 cut(s) 66, 217, 237
DpnII GATC 3 cut(s) 64, 215, 235
DrdI GACNNNNNNGTC 1 cut(s) 268
DseDI GACNNNNNNGTC 1 cut(s) 268
EaeI YGGCCR 1 cut(s) 41
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
EciI GGCGGA 1 cut(s) 25
Eco130I CCWWGG 1 cut(s) 239
Eco47I GGWCC 3 cut(s) 60, 140, 210
EcoO109I RGGNCCY 1 cut(s) 122
EcoRII CCWGG 2 cut(s) 38, 114
EcoT14I CCWWGG 1 cut(s) 239
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 1 cut(s) 14
FaiI YATR 2 cut(s) 12, 93
FaqI GGGAC 1 cut(s) 269
FatI CATG 1 cut(s) 10
FauI CCCGC 1 cut(s) 246
Fnu4HI GCNGC 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 44
FspBI CTAG 2 cut(s) 198, 240
GlaI GCGC 1 cut(s) 86
GluI GCNGC 1 cut(s) 44
HaeII RGCGCY 1 cut(s) 88
HaeIII GGCC 2 cut(s) 43, 124
HapII CCGG 1 cut(s) 208
HhaI GCGC 1 cut(s) 87
Hin1II CATG 1 cut(s) 14
Hin6I GCGC 1 cut(s) 85
HinP1I GCGC 1 cut(s) 85
HinfI GANTC 3 cut(s) 14, 32, 257
HpaII CCGG 1 cut(s) 208
Hpy166II GTNNAC 2 cut(s) 73, 110
Hpy188I TCNGA 3 cut(s) 28, 64, 155
Hpy188III TCNNGA 5 cut(s) 11, 166, 193, 213, 229
Hpy8I GTNNAC 2 cut(s) 73, 110
Hpy99I CGWCG 3 cut(s) 32, 137, 253
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 1 cut(s) 14
HspAI GCGC 1 cut(s) 85
Kzo9I GATC 3 cut(s) 64, 215, 235
LguI GCTCTTC 1 cut(s) 164
LmnI GCTCC 2 cut(s) 164, 195
MaeI CTAG 2 cut(s) 198, 240
MaeII ACGT 1 cut(s) 69
MalI GATC 3 cut(s) 66, 217, 237
MboI GATC 3 cut(s) 64, 215, 235
MboII GAAGA 1 cut(s) 181
MflI RGATCY 2 cut(s) 215, 235
MlyI GAGTC 3 cut(s) 23, 26, 251
MmeI TCCRAC 3 cut(s) 42, 51, 243
MnlI CCTC 3 cut(s) 18, 131, 149
MspI CCGG 1 cut(s) 208
MspR9I CCNGG 2 cut(s) 40, 116
MvaI CCWGG 2 cut(s) 40, 116
MvnI CGCG 1 cut(s) 253
NdeII GATC 3 cut(s) 64, 215, 235
NlaIII CATG 1 cut(s) 14
NlaIV GGNNCC 2 cut(s) 123, 160
NspV TTCGAA 1 cut(s) 266
PagI TCATGA 1 cut(s) 10
PciSI GCTCTTC 1 cut(s) 164
PcsI WCGNNNNNNNCGW 1 cut(s) 257
PkrI GCNGC 1 cut(s) 45
PleI GAGTC 3 cut(s) 22, 26, 251
PpsI GAGTC 3 cut(s) 22, 26, 251
Psp6I CCWGG 2 cut(s) 38, 114
PspGI CCWGG 2 cut(s) 38, 114
PspN4I GGNNCC 2 cut(s) 123, 160
PspPI GGNCC 4 cut(s) 60, 122, 140, 210
PsuI RGATCY 2 cut(s) 215, 235
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
Rsr2I CGGWCCG 1 cut(s) 60
RsrII CGGWCCG 1 cut(s) 60
SapI GCTCTTC 1 cut(s) 164
SatI GCNGC 1 cut(s) 44
Sau3AI GATC 3 cut(s) 64, 215, 235
Sau96I GGNCC 4 cut(s) 60, 122, 140, 210
SchI GAGTC 3 cut(s) 23, 26, 251
ScrFI CCNGG 2 cut(s) 40, 116
SetI ASST 3 cut(s) 72, 120, 131
SfcI CTRYAG 1 cut(s) 103
SfuI TTCGAA 1 cut(s) 266
SinI GGWCC 3 cut(s) 60, 140, 210
SpeI ACTAGT 1 cut(s) 197
SsiI CCGC 4 cut(s) 36, 44, 253, 273
SspMI CTAG 2 cut(s) 198, 240
StyD4I CCNGG 2 cut(s) 38, 114
StyI CCWWGG 1 cut(s) 239
TaaI ACNGT 1 cut(s) 107
TaiI ACGT 1 cut(s) 72
TaqI TCGA 2 cut(s) 260, 266
TaqII GACCGA 1 cut(s) 48
TatI WGTACW 1 cut(s) 107
TauI GCSGC 1 cut(s) 46
TspGWI ACGGA 1 cut(s) 150
VpaK11BI GGWCC 3 cut(s) 60, 140, 210
XmaJI CCTAGG 1 cut(s) 239
XspI CTAG 2 cut(s) 198, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.