Rh6CG248300

Belongs to the STXBP unc-18 SEC1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0005697
Physical Location & Seq
Reverse (-)
41846886 .. 41847200
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG248300.1

Sequence Viewer

Length: 315 bp
ATGGAGGCTTTGATGGAGGGAAAGCCAAATCCAGAAGTTGATTCTTACCTTATGTTTGATCCTCGTGCTCCAGAGTCAAGCTCTGGAAGCAACCATTTAAAAGGACCTGTTAAGGAGGCTATAGTGTTCATGGTTGGTGGTGGTAATTATGTGTACGGGAGCCTGCAAGAGCTTGTACAGCGTCAACAGCCTACGAGGCATGTTATCTATGGAACAACAGAAATACTCACAGCAGAGGATTTTGTGAAGCAGCTTGCTATTTTGGGCCAGAAAATGGGATTGGGTGGTGCTCCTGTTGCTGCTCCAACTCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sec1

Protein Analysis

104

Amino Acids

11.19

Weight (kDa)

5.24

Isoelectric Point (pI)

47.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sec1 PF00995 1 - 84 2e-11 Sec1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 274
AclWI GGATC 1 cut(s) 53
AfaI GTAC 2 cut(s) 155, 177
AfiI CCNNNNNNNGG 1 cut(s) 274
AjuI GAANNNNNNNTTGG 2 cut(s) 263, 295
AluBI AGCT 3 cut(s) 81, 172, 253
AluI AGCT 3 cut(s) 81, 172, 253
Alw21I GWGCWC 2 cut(s) 70, 292
AlwI GGATC 1 cut(s) 53
AoxI GGCC 1 cut(s) 265
ApeKI GCWGC 2 cut(s) 250, 299
AspS9I GGNCC 2 cut(s) 104, 265
AvaII GGWCC 1 cut(s) 104
BauI CACGAG 1 cut(s) 63
Bbv12I GWGCWC 2 cut(s) 70, 292
BbvI GCAGC 2 cut(s) 262, 286
BccI CCATC 1 cut(s) 7
BfmI CTRYAG 1 cut(s) 120
BglI GCCNNNNNGGC 1 cut(s) 196
BisI GCNGC 2 cut(s) 251, 300
BlsI GCNGC 2 cut(s) 252, 301
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 104, 265
BmiI GGNNCC 1 cut(s) 161
BplI GAGNNNNNCTC 2 cut(s) 65, 97
BpmI CTGGAG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 274
BseLI CCNNNNNNNGG 1 cut(s) 274
BseXI GCAGC 2 cut(s) 262, 286
BshFI GGCC 1 cut(s) 267
BsiHKAI GWGCWC 2 cut(s) 70, 292
BslI CCNNNNNNNGG 1 cut(s) 274
BsnI GGCC 1 cut(s) 267
Bsp1286I GDGCHC 2 cut(s) 70, 292
Bsp1407I TGTACA 1 cut(s) 175
Bsp143I GATC 1 cut(s) 58
BspANI GGCC 1 cut(s) 267
BspLI GGNNCC 1 cut(s) 161
BspPI GGATC 1 cut(s) 53
BsrGI TGTACA 1 cut(s) 175
BssMI GATC 1 cut(s) 58
BssSI CACGAG 1 cut(s) 63
Bst2BI CACGAG 1 cut(s) 63
BstAUI TGTACA 1 cut(s) 175
BstC8I GCNNGC 2 cut(s) 164, 255
BstDEI CTNAG 1 cut(s) 309
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstMWI GCNNNNNNNGC 5 cut(s) 87, 178, 187, 196, 296
BstNSI RCATGY 1 cut(s) 203
BstSFI CTRYAG 1 cut(s) 120
BstV1I GCAGC 2 cut(s) 262, 286
BsuRI GGCC 1 cut(s) 267
Cac8I GCNNGC 2 cut(s) 164, 255
Cfr13I GGNCC 2 cut(s) 104, 265
CseI GACGC 1 cut(s) 170
Csp6I GTAC 2 cut(s) 154, 176
CviAII CATG 2 cut(s) 130, 200
CviJI RGCY 9 cut(s) 8, 25, 81, 119, 162, 172, 190, 253, 267
CviKI_1 RGCY 9 cut(s) 8, 25, 81, 119, 162, 172, 190, 253, 267
CviQI GTAC 2 cut(s) 154, 176
DdeI CTNAG 1 cut(s) 309
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
DraI TTTAAA 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 104
EcoO109I RGGNCCY 1 cut(s) 104
FaeI CATG 2 cut(s) 133, 203
FaiI YATR 6 cut(s) 53, 122, 131, 150, 201, 210
FatI CATG 2 cut(s) 129, 199
Fnu4HI GCNGC 2 cut(s) 251, 300
Fsp4HI GCNGC 2 cut(s) 251, 300
GluI GCNGC 2 cut(s) 251, 300
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 267
HgaI GACGC 1 cut(s) 170
Hin1II CATG 2 cut(s) 133, 203
HincII GTYRAC 1 cut(s) 185
HindII GTYRAC 1 cut(s) 185
HinfI GANTC 2 cut(s) 41, 74
Hpy166II GTNNAC 2 cut(s) 154, 185
Hpy188III TCNNGA 3 cut(s) 32, 71, 84
Hpy8I GTNNAC 2 cut(s) 154, 185
HpyCH4V TGCA 1 cut(s) 166
HpyF10VI GCNNNNNNNGC 5 cut(s) 87, 178, 187, 196, 296
HpyF3I CTNAG 1 cut(s) 309
Hsp92II CATG 2 cut(s) 133, 203
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 4 cut(s) 73, 159, 295, 307
LpnPI CCDG 7 cut(s) 45, 69, 84, 120, 176, 281, 306
Lsp1109I GCAGC 2 cut(s) 262, 286
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MhlI GDGCHC 2 cut(s) 70, 292
MluCI AATT 1 cut(s) 145
MlyI GAGTC 1 cut(s) 83
MnlI CCTC 5 cut(s) 10, 72, 109, 189, 229
MseI TTAA 2 cut(s) 98, 111
MwoI GCNNNNNNNGC 5 cut(s) 87, 178, 187, 196, 296
NdeII GATC 1 cut(s) 58
NlaIII CATG 2 cut(s) 133, 203
NlaIV GGNNCC 1 cut(s) 161
NspI RCATGY 1 cut(s) 203
PfeI GAWTC 1 cut(s) 41
PflMI CCANNNNNTGG 1 cut(s) 274
PkrI GCNGC 2 cut(s) 252, 301
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
PpuMI RGGWCCY 1 cut(s) 104
Psp5II RGGWCCY 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 161
PspPI GGNCC 2 cut(s) 104, 265
PspPPI RGGWCCY 1 cut(s) 104
RsaI GTAC 2 cut(s) 155, 177
RsaNI GTAC 2 cut(s) 154, 176
SaqAI TTAA 2 cut(s) 98, 111
SatI GCNGC 2 cut(s) 251, 300
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 2 cut(s) 104, 265
SchI GAGTC 1 cut(s) 83
SduI GDGCHC 2 cut(s) 70, 292
SetI ASST 5 cut(s) 51, 83, 109, 174, 255
SfcI CTRYAG 1 cut(s) 120
SinI GGWCC 1 cut(s) 104
Sse9I AATT 1 cut(s) 145
TasI AATT 1 cut(s) 145
TatI WGTACW 1 cut(s) 175
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 2 cut(s) 98, 111
Tru9I TTAA 2 cut(s) 98, 111
TseI GCWGC 2 cut(s) 250, 299
TspDTI ATGAA 1 cut(s) 118
Van91I CCANNNNNTGG 1 cut(s) 274
VpaK11BI GGWCC 1 cut(s) 104
XceI RCATGY 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.