Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6C

Orthogroup ID

OG0005697

Physical Location & Seq

Genomic Coordinates Reverse (-)

41847291 .. 41847470

Gene Structure 180 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6CG248400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGTATCTCATTTCATCAGAAAGCATTAACCAGGGAGAAGTCGAATTAATGGAAGCGGCCCTCAGGAAGTCTGAGGTTGATACCCGTGCATTTCAGTATGCGAAGAAGAGCAAGTTGCTGAATGTCTCATTGGCATCAGCAAATTCTGCCAGCAGAAGCAATATAGTTGATTGGGCATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Sec1

Protein Analysis

59

Amino Acids

6.52

Weight (kDa)

6.13

Isoelectric Point (pI)

35.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005697)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G17980 AT4G31740
fragaria_vesca	FvH4_2g16530 FvH4_5g21350
malus_domestica	MD05G1133700.v1.1 MD10G1138700.v1.1
prunus_persica	Prupe.8G177500_v2.0.a1
pyrus_communis	pycom05g13050 pycom10g11790
rosa_chinensis	RchiOBHm_Chr6g0280551 RchiOBHm_Chr7g0225341
rosa_laevigata	RLG00000001829 RLG00000013055
rosa_multiflora	Rmu_co8087732.1_g000001 Rmu_sc0000259.1_g000036 Rmu_sc0015818.1_g000006
rosa_roxburghii	Rroxscaffold_3G00233920
rosa_rugosa	Rorug07G0228500
rosa_samantha	Rh6AG244500 Rh6BG246900 Rh6CG248300 Rh6CG248400 Rh6DG239700 Rh7AG374600 Rh7BG363500 Rh7CG393100 Rh7DG374300
rosa_wichuraiana	Rw7G031590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	56
AcsI	RAATTY	1 cut(s)	142
AjnI	CCWGG	1 cut(s)	30
AjuI	GAANNNNNNNTTGG	2 cut(s)	113, 145
Alw26I	GTCTC	1 cut(s)	130
AoxI	GGCC	1 cut(s)	57
ApoI	RAATTY	1 cut(s)	142
AseI	ATTAAT	1 cut(s)	47
AspS9I	GGNCC	1 cut(s)	58
AxyI	CCTNAGG	1 cut(s)	62
BciT130I	CCWGG	1 cut(s)	32
BcoDI	GTCTC	1 cut(s)	130
BisI	GCNGC	1 cut(s)	57
BlsI	GCNGC	1 cut(s)	58
Bme1390I	CCNGG	1 cut(s)	32
BmgT120I	GGNCC	1 cut(s)	58
BmrFI	CCNGG	1 cut(s)	32
BmsI	GCATC	1 cut(s)	143
BsaJI	CCNNGG	1 cut(s)	31
Bse21I	CCTNAGG	1 cut(s)	62
BseBI	CCWGG	1 cut(s)	32
BseDI	CCNNGG	1 cut(s)	31
BseMII	CTCAG	2 cut(s)	63, 76
BshFI	GGCC	1 cut(s)	59
BsmAI	GTCTC	1 cut(s)	130
BsnI	GGCC	1 cut(s)	59
BspACI	CCGC	1 cut(s)	56
BspANI	GGCC	1 cut(s)	59
BspCNI	CTCAG	2 cut(s)	64, 75
BspQI	GCTCTTC	1 cut(s)	101
BssECI	CCNNGG	1 cut(s)	31
Bst2UI	CCWGG	1 cut(s)	32
Bst6I	CTCTTC	1 cut(s)	101
BstAPI	GCANNNNNTGC	1 cut(s)	146
BstC8I	GCNNGC	1 cut(s)	151
BstDEI	CTNAG	2 cut(s)	62, 72
BstMAI	GTCTC	1 cut(s)	130
BstMWI	GCNNNNNNNGC	1 cut(s)	146
BstNI	CCWGG	1 cut(s)	32
BstSCI	CCNGG	1 cut(s)	30
Bsu36I	CCTNAGG	1 cut(s)	62
BsuRI	GGCC	1 cut(s)	59
Cac8I	GCNNGC	1 cut(s)	151
Cfr13I	GGNCC	1 cut(s)	58
CviJI	RGCY	1 cut(s)	59
CviKI_1	RGCY	1 cut(s)	59
DdeI	CTNAG	2 cut(s)	62, 72
Eam1104I	CTCTTC	1 cut(s)	101
EarI	CTCTTC	1 cut(s)	101
Eco81I	CCTNAGG	1 cut(s)	62
EcoRII	CCWGG	1 cut(s)	30
FaiI	YATR	3 cut(s)	99, 164, 178
Fnu4HI	GCNGC	1 cut(s)	57
Fsp4HI	GCNGC	1 cut(s)	57
GluI	GCNGC	1 cut(s)	57
HaeIII	GGCC	1 cut(s)	59
Hpy188I	TCNGA	2 cut(s)	19, 73
Hpy188III	TCNNGA	1 cut(s)	64
HpyCH4V	TGCA	1 cut(s)	89
HpyF10VI	GCNNNNNNNGC	1 cut(s)	146
HpyF3I	CTNAG	2 cut(s)	62, 72
LguI	GCTCTTC	1 cut(s)	101
LpnPI	CCDG	4 cut(s)	17, 44, 49, 163
LweI	GCATC	1 cut(s)	143
MboII	GAAGA	2 cut(s)	115, 118
MluCI	AATT	2 cut(s)	44, 142
MnlI	CCTC	2 cut(s)	67, 71
MseI	TTAA	2 cut(s)	27, 47
MspR9I	CCNGG	1 cut(s)	32
MvaI	CCWGG	1 cut(s)	32
MwoI	GCNNNNNNNGC	1 cut(s)	146
PciSI	GCTCTTC	1 cut(s)	101
PkrI	GCNGC	1 cut(s)	58
PshBI	ATTAAT	1 cut(s)	47
Psp6I	CCWGG	1 cut(s)	30
PspGI	CCWGG	1 cut(s)	30
PspPI	GGNCC	1 cut(s)	58
SapI	GCTCTTC	1 cut(s)	101
SaqAI	TTAA	2 cut(s)	27, 47
SatI	GCNGC	1 cut(s)	57
Sau96I	GGNCC	1 cut(s)	58
ScrFI	CCNGG	1 cut(s)	32
SetI	ASST	1 cut(s)	78
SfaNI	GCATC	1 cut(s)	143
SgeI	CNNG	7 cut(s)	43, 44, 76, 96, 98, 124, 162
Sse9I	AATT	2 cut(s)	44, 142
SsiI	CCGC	1 cut(s)	56
StyD4I	CCNGG	1 cut(s)	30
TaqI	TCGA	1 cut(s)	42
TasI	AATT	2 cut(s)	44, 142
TauI	GCSGC	1 cut(s)	59
Tru1I	TTAA	2 cut(s)	27, 47
Tru9I	TTAA	2 cut(s)	27, 47
VspI	ATTAAT	1 cut(s)	47
XapI	RAATTY	1 cut(s)	142

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.