Rh6DG323700

Non-specific lipid-transfer protein-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
52857103 .. 52858023
921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG323700.1

Sequence Viewer

Length: 597 bp
ATGGAACCCTTCAAGCCCTTTCTTTCAGTTCTTGTAGTACTCATTTCACCGCTAATTTTAGTTAATGGGCAGATTAGTACACCATGCACAGCCTCAAAGCTTAGCACCTTAACTCCATGCTTGAATTATATAACTGGGAGTACCAACAATGGCTCATCGCCAACAGGGGACTGTTGCTATGCGCTAAAGACCAGCATGGACTGCGCTTGCCTTTTAGTAACCGCCAATGTCCCAATCCAACTGCCCATTAACAGAACCCTTGCTCTCTCTCTTCCTAAAGCATGTAAAATGGGGAGTGTGCCACTACAATGCAAAGCTTCTGCTACTCCTTTAGCTGCCCCAGGTCCTTCCTTACTAGGACCAACTATTTCCCCCACAGCTGCTGATTCTCCGTTAAGTCCAAGAGCTTCTAAAGCAGTAGCAACAGGTCCTGCACCACAATCTGAAGCAGAATCTCCATCAGTTGAACCTGAAGCTCCGACAACTGCAATCAATCGACCAGTGCTGACGCCATCTGCAGCCTCTAGTCTATCTTATGTTTCTCCACAACCTCTGCTACTCATAGTTTTAGGAATCATGGTTTATAAATCCTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

198

Amino Acids

20.28

Weight (kDa)

8.43

Isoelectric Point (pI)

57.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LTP_2 PF14368 21 - 104 5.1e-17 Probable lipid transfer
Tryp_alpha_amyl PF00234 34 - 104 3.1e-07 Protease inhibitor/seed storage/LTP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012814)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 585
AciI CCGC 2 cut(s) 50, 222
AcuI CTGAAG 2 cut(s) 465, 492
AcyI GRCGYC 1 cut(s) 509
AfaI GTAC 3 cut(s) 39, 79, 142
AgsI TTSAA 3 cut(s) 13, 124, 467
AjnI CCWGG 1 cut(s) 340
AluBI AGCT 6 cut(s) 100, 317, 335, 380, 407, 476
AluI AGCT 6 cut(s) 100, 317, 335, 380, 407, 476
AlwNI CAGNNNCTG 2 cut(s) 383, 431
ApeKI GCWGC 3 cut(s) 335, 380, 518
AspLEI GCGC 2 cut(s) 184, 206
AspS9I GGNCC 3 cut(s) 344, 359, 428
AsuHPI GGTGA 1 cut(s) 39
AvaII GGWCC 3 cut(s) 344, 359, 428
BbvI GCAGC 3 cut(s) 322, 367, 530
BccI CCATC 2 cut(s) 466, 520
BciT130I CCWGG 1 cut(s) 342
BfaI CTAG 3 cut(s) 356, 525, 595
BfmI CTRYAG 1 cut(s) 516
BisI GCNGC 3 cut(s) 336, 381, 519
BlpI GCTNAGC 1 cut(s) 101
BlsI GCNGC 3 cut(s) 337, 382, 520
BmcAI AGTACT 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 342
Bme18I GGWCC 3 cut(s) 344, 359, 428
BmgT120I GGNCC 3 cut(s) 344, 359, 428
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 342
BmrI ACTGGG 1 cut(s) 144
BmuI ACTGGG 1 cut(s) 144
Bpu1102I GCTNAGC 1 cut(s) 101
BsaHI GRCGYC 1 cut(s) 509
BsaJI CCNNGG 1 cut(s) 340
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bse1I ACTGG 2 cut(s) 139, 500
BseBI CCWGG 1 cut(s) 342
BseDI CCNNGG 1 cut(s) 340
BseNI ACTGG 2 cut(s) 139, 500
BseXI GCAGC 3 cut(s) 322, 367, 530
BsgI GTGCAG 1 cut(s) 417
BslFI GGGAC 2 cut(s) 182, 215
BsmFI GGGAC 2 cut(s) 182, 215
Bsp1720I GCTNAGC 1 cut(s) 101
BspACI CCGC 2 cut(s) 50, 222
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 520
BsrI ACTGG 2 cut(s) 139, 500
BssECI CCNNGG 1 cut(s) 340
BssNI GRCGYC 1 cut(s) 509
Bst2UI CCWGG 1 cut(s) 342
Bst4CI ACNGT 1 cut(s) 173
Bst6I CTCTTC 1 cut(s) 276
BstACI GRCGYC 1 cut(s) 509
BstAPI GCANNNNNTGC 1 cut(s) 201
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 101
BstHHI GCGC 2 cut(s) 184, 206
BstMWI GCNNNNNNNGC 2 cut(s) 201, 413
BstNI CCWGG 1 cut(s) 342
BstNSI RCATGY 1 cut(s) 285
BstSCI CCNGG 1 cut(s) 340
BstSFI CTRYAG 1 cut(s) 516
BstV1I GCAGC 3 cut(s) 322, 367, 530
BtgZI GCGATG 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 507
Cac8I GCNNGC 1 cut(s) 208
CaiI CAGNNNCTG 2 cut(s) 383, 431
CfoI GCGC 2 cut(s) 184, 206
Cfr13I GGNCC 3 cut(s) 344, 359, 428
CseI GACGC 1 cut(s) 517
Csp6I GTAC 3 cut(s) 38, 78, 141
CviAII CATG 5 cut(s) 84, 117, 196, 282, 577
CviQI GTAC 3 cut(s) 38, 78, 141
DdeI CTNAG 1 cut(s) 101
Eam1104I CTCTTC 1 cut(s) 276
EarI CTCTTC 1 cut(s) 276
Eco47I GGWCC 3 cut(s) 344, 359, 428
Eco57I CTGAAG 2 cut(s) 465, 492
EcoO109I RGGNCCY 2 cut(s) 344, 428
EcoRII CCWGG 1 cut(s) 340
FaeI CATG 5 cut(s) 87, 120, 199, 285, 580
FaqI GGGAC 2 cut(s) 182, 215
FatI CATG 5 cut(s) 83, 116, 195, 281, 576
Fnu4HI GCNGC 3 cut(s) 336, 381, 519
Fsp4HI GCNGC 3 cut(s) 336, 381, 519
FspBI CTAG 3 cut(s) 356, 525, 595
GlaI GCGC 2 cut(s) 183, 205
GluI GCNGC 3 cut(s) 336, 381, 519
HgaI GACGC 1 cut(s) 517
HhaI GCGC 2 cut(s) 184, 206
Hin1I GRCGYC 1 cut(s) 509
Hin1II CATG 5 cut(s) 87, 120, 199, 285, 580
Hin6I GCGC 2 cut(s) 182, 204
HinP1I GCGC 2 cut(s) 182, 204
HindIII AAGCTT 2 cut(s) 98, 315
HinfI GANTC 3 cut(s) 386, 452, 573
HphI GGTGA 1 cut(s) 39
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 2 cut(s) 445, 480
Hpy8I GTNNAC 1 cut(s) 80
HpyAV CCTTC 2 cut(s) 19, 357
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4V TGCA 5 cut(s) 87, 312, 434, 488, 518
HpyF10VI GCNNNNNNNGC 2 cut(s) 201, 413
HpyF3I CTNAG 1 cut(s) 101
Hsp92I GRCGYC 1 cut(s) 509
Hsp92II CATG 5 cut(s) 87, 120, 199, 285, 580
HspAI GCGC 2 cut(s) 182, 204
LmnI GCTCC 1 cut(s) 481
LpnPI CCDG 9 cut(s) 120, 150, 205, 327, 354, 411, 444, 483, 513
Lsp1109I GCAGC 3 cut(s) 322, 367, 530
MaeI CTAG 3 cut(s) 356, 525, 595
MaeIII GTNAC 1 cut(s) 217
MboII GAAGA 1 cut(s) 263
MluCI AATT 2 cut(s) 54, 124
MmeI TCCRAC 2 cut(s) 262, 503
MnlI CCTC 3 cut(s) 103, 532, 561
MseI TTAA 4 cut(s) 63, 110, 249, 395
MslI CAYNNNNRTG 1 cut(s) 307
MspA1I CMGCKG 1 cut(s) 380
MspR9I CCNGG 1 cut(s) 342
MvaI CCWGG 1 cut(s) 342
MwoI GCNNNNNNNGC 2 cut(s) 201, 413
NlaIII CATG 5 cut(s) 87, 120, 199, 285, 580
NlaIV GGNNCC 1 cut(s) 6
NspI RCATGY 1 cut(s) 285
PfeI GAWTC 3 cut(s) 386, 452, 573
PkrI GCNGC 3 cut(s) 337, 382, 520
PpuMI RGGWCCY 2 cut(s) 344, 428
PsiI TTATAA 1 cut(s) 585
Psp5II RGGWCCY 2 cut(s) 344, 428
Psp6I CCWGG 1 cut(s) 340
PspGI CCWGG 1 cut(s) 340
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 3 cut(s) 344, 359, 428
PspPPI RGGWCCY 2 cut(s) 344, 428
PstI CTGCAG 1 cut(s) 520
PstNI CAGNNNCTG 2 cut(s) 383, 431
PvuII CAGCTG 1 cut(s) 380
RsaI GTAC 3 cut(s) 39, 79, 142
RsaNI GTAC 3 cut(s) 38, 78, 141
RseI CAYNNNNRTG 1 cut(s) 307
SaqAI TTAA 4 cut(s) 63, 110, 249, 395
SatI GCNGC 3 cut(s) 336, 381, 519
Sau96I GGNCC 3 cut(s) 344, 359, 428
ScaI AGTACT 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 342
SfcI CTRYAG 1 cut(s) 516
SinI GGWCC 3 cut(s) 344, 359, 428
SmiMI CAYNNNNRTG 1 cut(s) 307
Sse9I AATT 2 cut(s) 54, 124
SsiI CCGC 2 cut(s) 50, 222
SspMI CTAG 3 cut(s) 356, 525, 595
StyD4I CCNGG 1 cut(s) 340
TaaI ACNGT 1 cut(s) 173
TaqI TCGA 1 cut(s) 496
TasI AATT 2 cut(s) 54, 124
TatI WGTACW 2 cut(s) 37, 77
TfiI GAWTC 3 cut(s) 386, 452, 573
Tru1I TTAA 4 cut(s) 63, 110, 249, 395
Tru9I TTAA 4 cut(s) 63, 110, 249, 395
TscAI CASTG 1 cut(s) 507
TseI GCWGC 3 cut(s) 335, 380, 518
TspGWI ACGGA 1 cut(s) 381
TspRI CASTG 1 cut(s) 507
VpaK11BI GGWCC 3 cut(s) 344, 359, 428
XceI RCATGY 1 cut(s) 285
XspI CTAG 3 cut(s) 356, 525, 595
ZrmI AGTACT 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.