Rh7BG148900

Glutelin type-A

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
11054368 .. 11054854
487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG148900.1

Sequence Viewer

Length: 420 bp
ATGGAGATTGATCTTACACCAAGGTTAGCTAAGAAGGTTTATGGAGGAGATGGTGGTTCCTACTTTGCCTGGTCCTTATCGGAGCTTCCCATACTCCGTGAAGGAGACATTGGAGCTGCCAAGCTCTCTCTAGAAAAGGACGGCTTTGCTCTCCCCAATTACTATGACTCTGCCAAGAGTTGCTTATGTCCTTCAGGAGAAAATATGGAGATTGATCTTACACCAAGGTTAGCTAATAAGGTTTATGGAGGAGATGGTGGTTCCTACTTTGCCTGGTCCTCATTGGAGCTTCTCATACTCCGTGAAGGAGACATTGGAGCTGCCAAGCTCTCTCTAGAAAAGGACAGCTTTGCTCTCCCCAATTACTCTGACTCTACCAAGATGCTTATGTCCTTCAGGGTAATTGTTTTTGATATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.19

Weight (kDa)

4.62

Isoelectric Point (pI)

41.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 177, 379
AjnI CCWGG 2 cut(s) 68, 272
AjuI GAANNNNNNNTTGG 4 cut(s) 93, 125, 297, 329
AluBI AGCT 9 cut(s) 29, 85, 116, 124, 233, 289, 320, 328, 348
AluI AGCT 9 cut(s) 29, 85, 116, 124, 233, 289, 320, 328, 348
Alw26I GTCTC 2 cut(s) 99, 303
ApeKI GCWGC 2 cut(s) 116, 320
AspS9I GGNCC 2 cut(s) 72, 276
AvaII GGWCC 2 cut(s) 72, 276
BbvI GCAGC 2 cut(s) 103, 307
BccI CCATC 2 cut(s) 44, 248
BceAI ACGGC 1 cut(s) 157
BciT130I CCWGG 2 cut(s) 70, 274
BcoDI GTCTC 2 cut(s) 99, 303
BfaI CTAG 2 cut(s) 131, 335
BisI GCNGC 2 cut(s) 117, 321
BlsI GCNGC 2 cut(s) 118, 322
Bme1390I CCNGG 2 cut(s) 70, 274
Bme18I GGWCC 2 cut(s) 72, 276
BmgT120I GGNCC 2 cut(s) 72, 276
BmiI GGNNCC 2 cut(s) 58, 262
BmrFI CCNGG 2 cut(s) 70, 274
BmsI GCATC 1 cut(s) 372
BsaJI CCNNGG 2 cut(s) 20, 224
BseBI CCWGG 2 cut(s) 70, 274
BseDI CCNNGG 2 cut(s) 20, 224
BseRI GAGGAG 2 cut(s) 60, 264
BseXI GCAGC 2 cut(s) 103, 307
BsmAI GTCTC 2 cut(s) 99, 303
Bsp143I GATC 2 cut(s) 10, 214
BspLI GGNNCC 2 cut(s) 58, 262
BssECI CCNNGG 2 cut(s) 20, 224
BssMI GATC 2 cut(s) 10, 214
BssT1I CCWWGG 2 cut(s) 20, 224
Bst2UI CCWGG 2 cut(s) 70, 274
BstDEI CTNAG 1 cut(s) 30
BstKTI GATC 2 cut(s) 13, 217
BstMAI GTCTC 2 cut(s) 99, 303
BstMBI GATC 2 cut(s) 10, 214
BstNI CCWGG 2 cut(s) 70, 274
BstSCI CCNGG 2 cut(s) 68, 272
BstV1I GCAGC 2 cut(s) 103, 307
Cfr13I GGNCC 2 cut(s) 72, 276
DdeI CTNAG 1 cut(s) 30
DpnI GATC 2 cut(s) 12, 216
DpnII GATC 2 cut(s) 10, 214
Eco130I CCWWGG 2 cut(s) 20, 224
Eco47I GGWCC 2 cut(s) 72, 276
Eco57I CTGAAG 2 cut(s) 177, 379
EcoRII CCWGG 2 cut(s) 68, 272
EcoT14I CCWWGG 2 cut(s) 20, 224
ErhI CCWWGG 2 cut(s) 20, 224
FaiI YATR 8 cut(s) 42, 92, 165, 187, 206, 246, 296, 389
FalI AAGNNNNNCTT 6 cut(s) 128, 160, 167, 199, 332, 364
Fnu4HI GCNGC 2 cut(s) 117, 321
Fsp4HI GCNGC 2 cut(s) 117, 321
FspBI CTAG 2 cut(s) 131, 335
GluI GCNGC 2 cut(s) 117, 321
HinfI GANTC 2 cut(s) 167, 371
Hpy188I TCNGA 2 cut(s) 82, 370
Hpy188III TCNNGA 3 cut(s) 131, 195, 335
HpyAV CCTTC 5 cut(s) 28, 95, 201, 299, 403
HpyF3I CTNAG 1 cut(s) 30
Kzo9I GATC 2 cut(s) 10, 214
LmnI GCTCC 4 cut(s) 82, 113, 286, 317
LpnPI CCDG 6 cut(s) 55, 82, 180, 259, 286, 382
Lsp1109I GCAGC 2 cut(s) 103, 307
LweI GCATC 1 cut(s) 372
MaeI CTAG 2 cut(s) 131, 335
MalI GATC 2 cut(s) 12, 216
MboI GATC 2 cut(s) 10, 214
MluCI AATT 3 cut(s) 157, 361, 402
MlyI GAGTC 2 cut(s) 161, 365
MnlI CCTC 3 cut(s) 38, 242, 289
MspR9I CCNGG 2 cut(s) 70, 274
MvaI CCWGG 2 cut(s) 70, 274
NdeII GATC 2 cut(s) 10, 214
NlaIV GGNNCC 2 cut(s) 58, 262
PkrI GCNGC 2 cut(s) 118, 322
PleI GAGTC 2 cut(s) 161, 365
PpsI GAGTC 2 cut(s) 161, 365
Psp6I CCWGG 2 cut(s) 68, 272
PspGI CCWGG 2 cut(s) 68, 272
PspN4I GGNNCC 2 cut(s) 58, 262
PspPI GGNCC 2 cut(s) 72, 276
SatI GCNGC 2 cut(s) 117, 321
Sau3AI GATC 2 cut(s) 10, 214
Sau96I GGNCC 2 cut(s) 72, 276
SchI GAGTC 2 cut(s) 161, 365
ScrFI CCNGG 2 cut(s) 70, 274
SfaNI GCATC 1 cut(s) 372
SinI GGWCC 2 cut(s) 72, 276
Sse9I AATT 3 cut(s) 157, 361, 402
SspMI CTAG 2 cut(s) 131, 335
StyD4I CCNGG 2 cut(s) 68, 272
StyI CCWWGG 2 cut(s) 20, 224
TasI AATT 3 cut(s) 157, 361, 402
TseI GCWGC 2 cut(s) 116, 320
TspGWI ACGGA 2 cut(s) 86, 290
VpaK11BI GGWCC 2 cut(s) 72, 276
XbaI TCTAGA 2 cut(s) 130, 334
XspI CTAG 2 cut(s) 131, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.