Rw5G034310

Mitochondrial domain of unknown function (DUF1713)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0008619
Physical Location & Seq
Reverse (-)
59037024 .. 59037431
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G034310.1

Sequence Viewer

Length: 408 bp
ATGGAAGAGTTCCAAATTGCTAGCCATGTCTGGAGACTCACCAAAAACTCAAGCTCTCTAAGAACTCATCTTTTCCCTGAACATAAACCCTATCCCCTTACCCATCACAGTCATCTGGGCCCTCCTAAATTTGAATCCCAAGTTCCCCATTTGGGTCCTATAAGCGTTGACAAGGTCAAATTGTCGTTGCCAATTTTCCCTAGTTTTCCATTCAGGTACTACTTGAATCTGATTTCTCAAATTGGGTTGGAGCAATATGGACTGTGCGAGGCCGATGCAGTTGAATCTGATGATGCAGGGATGATTTGGGATGACAGCGTGAAGAAGAAAAGGAAGAGGAAGAGGAAGAGGAAGATGAACAAGCATAAGTTGAGGAAGCTGTGGAAAAGTCTTCGTCACAAGACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1713

Protein Analysis

135

Amino Acids

15.93

Weight (kDa)

10.04

Isoelectric Point (pI)

56.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 128
AfaI GTAC 1 cut(s) 218
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 3 cut(s) 134, 226, 284
AluBI AGCT 2 cut(s) 54, 379
AluI AGCT 2 cut(s) 54, 379
Alw26I GTCTC 1 cut(s) 28
AoxI GGCC 2 cut(s) 118, 270
ApaI GGGCCC 1 cut(s) 122
ApoI RAATTY 1 cut(s) 128
AspS9I GGNCC 3 cut(s) 118, 119, 155
AsuHPI GGTGA 1 cut(s) 31
AsuNHI GCTAGC 1 cut(s) 20
AvaII GGWCC 1 cut(s) 155
BaeGI GKGCMC 1 cut(s) 122
BanII GRGCYC 1 cut(s) 122
BbsI GAAGAC 1 cut(s) 383
BccI CCATC 1 cut(s) 111
BcgI CGANNNNNNTGC 2 cut(s) 257, 291
BcoDI GTCTC 1 cut(s) 28
BfaI CTAG 2 cut(s) 21, 201
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 3 cut(s) 118, 119, 155
BmiI GGNNCC 2 cut(s) 120, 156
BmsI GCATC 2 cut(s) 265, 283
BmtI GCTAGC 1 cut(s) 24
BpiI GAAGAC 1 cut(s) 383
BpmI CTGGAG 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseGI GGATG 2 cut(s) 306, 316
BseLI CCNNNNNNNGG 1 cut(s) 152
BseSI GKGCMC 1 cut(s) 122
BshFI GGCC 2 cut(s) 120, 272
BslI CCNNNNNNNGG 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 28
BsnI GGCC 2 cut(s) 120, 272
Bsp120I GGGCCC 1 cut(s) 118
Bsp1286I GDGCHC 1 cut(s) 122
BspANI GGCC 2 cut(s) 120, 272
BspLI GGNNCC 2 cut(s) 120, 156
BspOI GCTAGC 1 cut(s) 24
Bst4CI ACNGT 2 cut(s) 110, 264
Bst6I CTCTTC 3 cut(s) 329, 335, 341
BstC8I GCNNGC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 59
BstF5I GGATG 2 cut(s) 306, 316
BstMAI GTCTC 1 cut(s) 28
BstSLI GKGCMC 1 cut(s) 122
BstV2I GAAGAC 1 cut(s) 383
BsuRI GGCC 2 cut(s) 120, 272
BtsCI GGATG 2 cut(s) 306, 316
Cac8I GCNNGC 1 cut(s) 22
Cfr13I GGNCC 3 cut(s) 118, 119, 155
Csp6I GTAC 1 cut(s) 217
CviAII CATG 1 cut(s) 26
CviJI RGCY 5 cut(s) 24, 54, 120, 272, 379
CviKI_1 RGCY 5 cut(s) 24, 54, 120, 272, 379
CviQI GTAC 1 cut(s) 217
DdeI CTNAG 1 cut(s) 59
Eam1104I CTCTTC 3 cut(s) 329, 335, 341
EarI CTCTTC 3 cut(s) 329, 335, 341
Eco24I GRGCYC 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 155
EcoO109I RGGNCCY 2 cut(s) 119, 155
EcoT38I GRGCYC 1 cut(s) 122
FaeI CATG 1 cut(s) 29
FaiI YATR 5 cut(s) 27, 84, 161, 258, 366
FatI CATG 1 cut(s) 25
FokI GGATG 2 cut(s) 313, 323
FriOI GRGCYC 1 cut(s) 122
FspBI CTAG 2 cut(s) 21, 201
GsuI CTGGAG 1 cut(s) 52
HaeIII GGCC 2 cut(s) 120, 272
Hin1II CATG 1 cut(s) 29
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HinfI GANTC 4 cut(s) 36, 134, 226, 284
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 2 cut(s) 231, 289
Hpy188III TCNNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 169
HpyCH4III ACNGT 2 cut(s) 110, 264
HpyCH4V TGCA 2 cut(s) 278, 296
HpyF3I CTNAG 1 cut(s) 59
Hsp92II CATG 1 cut(s) 29
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 5 cut(s) 16, 90, 101, 199, 282
LweI GCATC 2 cut(s) 265, 283
MaeI CTAG 2 cut(s) 21, 201
MaeIII GTNAC 1 cut(s) 395
MboII GAAGA 8 cut(s) 17, 334, 337, 346, 352, 358, 364, 383
MhlI GDGCHC 1 cut(s) 122
MluCI AATT 5 cut(s) 15, 128, 179, 192, 240
MlyI GAGTC 1 cut(s) 30
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 6 cut(s) 132, 262, 330, 336, 342, 366
NheI GCTAGC 1 cut(s) 20
NlaIII CATG 1 cut(s) 29
NlaIV GGNNCC 2 cut(s) 120, 156
NmuCI GTSAC 1 cut(s) 395
PfeI GAWTC 3 cut(s) 134, 226, 284
PflFI GACNNNGTC 1 cut(s) 173
PleI GAGTC 1 cut(s) 30
PpsI GAGTC 1 cut(s) 30
PpuMI RGGWCCY 1 cut(s) 155
Psp5II RGGWCCY 1 cut(s) 155
PspN4I GGNNCC 2 cut(s) 120, 156
PspOMI GGGCCC 1 cut(s) 118
PspPI GGNCC 3 cut(s) 118, 119, 155
PspPPI RGGWCCY 1 cut(s) 155
PsyI GACNNNGTC 1 cut(s) 173
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
Sau96I GGNCC 3 cut(s) 118, 119, 155
SchI GAGTC 1 cut(s) 30
SduI GDGCHC 1 cut(s) 122
SetI ASST 5 cut(s) 56, 177, 218, 381, 407
SfaNI GCATC 2 cut(s) 265, 283
SinI GGWCC 1 cut(s) 155
SmlI CTYRAG 1 cut(s) 49
SmoI CTYRAG 1 cut(s) 49
Sse9I AATT 5 cut(s) 15, 128, 179, 192, 240
SspMI CTAG 2 cut(s) 21, 201
TaaI ACNGT 2 cut(s) 110, 264
TasI AATT 5 cut(s) 15, 128, 179, 192, 240
TfiI GAWTC 3 cut(s) 134, 226, 284
TseFI GTSAC 1 cut(s) 395
Tsp45I GTSAC 1 cut(s) 395
TspDTI ATGAA 1 cut(s) 371
Tth111I GACNNNGTC 1 cut(s) 173
VpaK11BI GGWCC 1 cut(s) 155
XapI RAATTY 1 cut(s) 128
XspI CTAG 2 cut(s) 21, 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.