AT1G15270

Translation machinery associated TMA7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0006696
Physical Location & Seq
Reverse (-)
5250650 .. 5252121
1472 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G15270.1

Sequence Viewer

Length: 195 bp
ATGTCTTCCAAGCAAGGAGGAAAGGCGAAACCTTTGAAGCAGCCTAAAGCTGATAAGAAGGAATACGACGAGACTGACTTAGCTAACATTCAGAAGAAGAAAGATGAGGAAAAGGCCCTTAAAGAGCTTAGAGCCAAGGCATCGCAGAAGGGATCCTTTGGAGGTTCTGGACTTAAGAAGAGTGGCAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMA7

Protein Analysis

64

Amino Acids

6.98

Weight (kDa)

9.95

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 64 1.5e-24 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 147, 160
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 3 cut(s) 50, 83, 127
AluI AGCT 3 cut(s) 50, 83, 127
Alw26I GTCTC 1 cut(s) 65
AlwI GGATC 2 cut(s) 147, 160
AoxI GGCC 1 cut(s) 114
ApeKI GCWGC 1 cut(s) 40
AspS9I GGNCC 1 cut(s) 115
BamHI GGATCC 1 cut(s) 152
BbvI GCAGC 1 cut(s) 52
BcoDI GTCTC 1 cut(s) 65
BfrI CTTAAG 1 cut(s) 173
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 115
BmiI GGNNCC 1 cut(s) 154
BmsI GCATC 1 cut(s) 149
BsaJI CCNNGG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 135
BseXI GCAGC 1 cut(s) 52
BshFI GGCC 1 cut(s) 116
BsmAI GTCTC 1 cut(s) 65
BsnI GGCC 1 cut(s) 116
Bsp143I GATC 1 cut(s) 152
BspANI GGCC 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 154
BspPI GGATC 2 cut(s) 147, 160
BspTI CTTAAG 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 1 cut(s) 152
BssT1I CCWWGG 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 173
BstAFI CTTAAG 1 cut(s) 173
BstDEI CTNAG 2 cut(s) 79, 128
BstKTI GATC 1 cut(s) 155
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 1 cut(s) 152
BstV1I GCAGC 1 cut(s) 52
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
BsuRI GGCC 1 cut(s) 116
BtgZI GCGATG 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 6 cut(s) 43, 50, 83, 116, 127, 134
CviKI_1 RGCY 6 cut(s) 43, 50, 83, 116, 127, 134
DdeI CTNAG 2 cut(s) 79, 128
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
Eco130I CCWWGG 1 cut(s) 135
EcoO109I RGGNCCY 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FalI AAGNNNNNCTT 2 cut(s) 140, 172
Fnu4HI GCNGC 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 41
GluI GCNGC 1 cut(s) 41
HaeIII GGCC 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 168
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 2 cut(s) 52, 142
HpyF3I CTNAG 2 cut(s) 79, 128
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 153
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 149
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 3 cut(s) 106, 109, 190
MflI RGATCY 1 cut(s) 152
MnlI CCTC 3 cut(s) 11, 100, 155
MseI TTAA 2 cut(s) 120, 174
MspCI CTTAAG 1 cut(s) 173
NdeII GATC 1 cut(s) 152
NlaIV GGNNCC 1 cut(s) 154
PkrI GCNGC 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 1 cut(s) 115
PsuI RGATCY 1 cut(s) 152
SaqAI TTAA 2 cut(s) 120, 174
SatI GCNGC 1 cut(s) 41
Sau3AI GATC 1 cut(s) 152
Sau96I GGNCC 1 cut(s) 115
SetI ASST 5 cut(s) 34, 52, 85, 129, 166
SfaNI GCATC 1 cut(s) 149
SgeI CNNG 5 cut(s) 22, 26, 82, 148, 180
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
StyI CCWWGG 1 cut(s) 135
Tru1I TTAA 2 cut(s) 120, 174
Tru9I TTAA 2 cut(s) 120, 174
TseI GCWGC 1 cut(s) 40
Vha464I CTTAAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.