Rh5AG147200

Translation machinery associated TMA7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0006696
Physical Location & Seq
Reverse (-)
15478530 .. 15480294
1765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG147200.1

Sequence Viewer

Length: 195 bp
ATGTCGTCCAAGCAAGGTGGAAAGGCAAAACCTTTGAAGCAACCCAAGACTGAGAAGAAGGAGTACGACGAGGATGATTTGGCCAAGCTTGAGAAGAAGAAGGATGAGGAAAAGGCACTGAAGGAGCTTAGAGCCAAGGCATTAGACAAAGGGTCTTTTGGAGGTGCTGGCCTTAAGAAGAGTGGAAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMA7

Protein Analysis

64

Amino Acids

7.05

Weight (kDa)

9.73

Isoelectric Point (pI)

38.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 64 4.4e-23 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 140
AfaI GTAC 1 cut(s) 65
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 1 cut(s) 37
AhdI GACNNNNNGTC 1 cut(s) 151
AluBI AGCT 2 cut(s) 88, 127
AluI AGCT 2 cut(s) 88, 127
AoxI GGCC 2 cut(s) 81, 169
BalI TGGCCA 1 cut(s) 83
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
BfrI CTTAAG 1 cut(s) 173
BmeRI GACNNNNNGTC 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 2 cut(s) 79, 109
BseMII CTCAG 1 cut(s) 42
BshFI GGCC 2 cut(s) 83, 171
BsnI GGCC 2 cut(s) 83, 171
BspANI GGCC 2 cut(s) 83, 171
BspCNI CTCAG 1 cut(s) 43
BspTI CTTAAG 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 135
BssT1I CCWWGG 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 173
BstAFI CTTAAG 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 2 cut(s) 51, 128
BstF5I GGATG 2 cut(s) 79, 109
BsuRI GGCC 2 cut(s) 83, 171
BtsCI GGATG 2 cut(s) 79, 109
BtsIMutI CAGTG 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 1 cut(s) 33
CviJI RGCY 5 cut(s) 83, 88, 127, 134, 171
CviKI_1 RGCY 5 cut(s) 83, 88, 127, 134, 171
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 2 cut(s) 51, 128
DriI GACNNNNNGTC 1 cut(s) 151
EaeI YGGCCR 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 173
Eam1105I GACNNNNNGTC 1 cut(s) 151
EarI CTCTTC 1 cut(s) 173
Eco130I CCWWGG 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 140
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FokI GGATG 2 cut(s) 86, 116
HaeIII GGCC 2 cut(s) 83, 171
HindIII AAGCTT 1 cut(s) 86
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 3 cut(s) 52, 94, 115
HpyF3I CTNAG 2 cut(s) 51, 128
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 153
MboII GAAGA 4 cut(s) 67, 106, 109, 190
MlsI TGGCCA 1 cut(s) 83
MluNI TGGCCA 1 cut(s) 83
MnlI CCTC 3 cut(s) 64, 100, 155
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
MseI TTAA 1 cut(s) 174
Msp20I TGGCCA 1 cut(s) 83
MspCI CTTAAG 1 cut(s) 173
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 174
SetI ASST 5 cut(s) 19, 34, 90, 129, 166
SgeI CNNG 8 cut(s) 22, 26, 58, 82, 97, 101, 148, 180
SmlI CTYRAG 2 cut(s) 89, 173
SmoI CTYRAG 2 cut(s) 89, 173
StyI CCWWGG 1 cut(s) 135
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 1 cut(s) 123
TspRI CASTG 1 cut(s) 123
Vha464I CTTAAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.