MD17G1194100.v1.1

Translation machinery associated TMA7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0006696
Physical Location & Seq
Reverse (-)
23281941 .. 23283712
1772 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1194100.v1.1.491

Sequence Viewer

Length: 195 bp
ATGTCTTCCAAGCAAGGTGGAAAAGCAAAGCCCTTGAAGGCACCCAAGGCCGACAAGAAGGAGTACGACGAGTCCGATTTGGCCAACCTTCAGAAGAAGAAAGAGGAGGAAAAGGCACTGAAGGAGCTTAGAGCCAAGGCACAACAGAAAGGGTCCTTCGGAGGTTCTGGGCTCAAGAAAAGCGGGAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMA7

Protein Analysis

65

Amino Acids

6.96

Weight (kDa)

9.95

Isoelectric Point (pI)

46.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 64 1e-24 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 40
AciI CCGC 1 cut(s) 183
AcoI YGGCCR 1 cut(s) 81
AcuI CTGAAG 2 cut(s) 74, 140
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
AoxI GGCC 2 cut(s) 48, 81
AspS9I GGNCC 1 cut(s) 153
AvaII GGWCC 1 cut(s) 153
BalI TGGCCA 1 cut(s) 83
BanI GGYRCC 1 cut(s) 40
BanII GRGCYC 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BmiI GGNNCC 2 cut(s) 42, 154
BpuEI CTTGAG 1 cut(s) 158
BsaJI CCNNGG 2 cut(s) 45, 135
BseDI CCNNGG 2 cut(s) 45, 135
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 2 cut(s) 50, 83
BshNI GGYRCC 1 cut(s) 40
BsnI GGCC 2 cut(s) 50, 83
Bsp1286I GDGCHC 1 cut(s) 174
BspACI CCGC 1 cut(s) 183
BspANI GGCC 2 cut(s) 50, 83
BspLI GGNNCC 2 cut(s) 42, 154
BspT107I GGYRCC 1 cut(s) 40
BssECI CCNNGG 2 cut(s) 45, 135
BssT1I CCWWGG 2 cut(s) 45, 135
BstDEI CTNAG 1 cut(s) 128
BstMWI GCNNNNNNNGC 1 cut(s) 47
BsuRI GGCC 2 cut(s) 50, 83
BtsIMutI CAGTG 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 1 cut(s) 33
CviJI RGCY 6 cut(s) 31, 50, 83, 127, 134, 172
CviKI_1 RGCY 6 cut(s) 31, 50, 83, 127, 134, 172
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 128
EaeI YGGCCR 1 cut(s) 81
Eco130I CCWWGG 2 cut(s) 45, 135
Eco24I GRGCYC 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 153
Eco57I CTGAAG 2 cut(s) 74, 140
EcoO109I RGGNCCY 1 cut(s) 153
EcoT14I CCWWGG 2 cut(s) 45, 135
EcoT38I GRGCYC 1 cut(s) 174
ErhI CCWWGG 2 cut(s) 45, 135
FauI CCCGC 1 cut(s) 176
FriOI GRGCYC 1 cut(s) 174
HaeIII GGCC 2 cut(s) 50, 83
HinfI GANTC 1 cut(s) 71
Hpy188I TCNGA 3 cut(s) 76, 93, 161
Hpy188III TCNNGA 1 cut(s) 175
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 5 cut(s) 31, 52, 98, 115, 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 128
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 153
MboII GAAGA 2 cut(s) 106, 109
MhlI GDGCHC 1 cut(s) 174
MlsI TGGCCA 1 cut(s) 83
MluNI TGGCCA 1 cut(s) 83
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 3 cut(s) 97, 100, 155
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
Msp20I TGGCCA 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 47
NlaIV GGNNCC 2 cut(s) 42, 154
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PpuMI RGGWCCY 1 cut(s) 153
Psp5II RGGWCCY 1 cut(s) 153
PspN4I GGNNCC 2 cut(s) 42, 154
PspPI GGNCC 1 cut(s) 153
PspPPI RGGWCCY 1 cut(s) 153
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
Sau96I GGNCC 1 cut(s) 153
SchI GAGTC 1 cut(s) 80
SduI GDGCHC 1 cut(s) 174
SetI ASST 4 cut(s) 19, 90, 129, 166
SgeI CNNG 9 cut(s) 22, 26, 46, 58, 67, 82, 148, 180, 187
SinI GGWCC 1 cut(s) 153
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
SsiI CCGC 1 cut(s) 183
StyI CCWWGG 2 cut(s) 45, 135
TscAI CASTG 1 cut(s) 123
TspRI CASTG 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.