Prupe.3G069900_v2.0.a1

Translation machinery associated TMA7

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
5031558 .. 5033274
1717 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G069900.1

Sequence Viewer

Length: 195 bp
ATGTCTTCCAAGCAAGGTGGAAAGGCGAAGCCTTTGAAGCAACCCAAGTCCGAGAAGAAAGAGTACGACGAGTCTGATTTGGCCAACATTCAGAAGAAAAAAGATGAGGAAAAGGCACTGAAGGAGCTTAGAGCCAAGGCACAACAGAAGGGATCCTTTGGAGGTGCTGGGCTCAAGAAAAGTGGGAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.02

Weight (kDa)

9.95

Isoelectric Point (pI)

51.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 147, 160
AcoI YGGCCR 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 140
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 1 cut(s) 127
AluI AGCT 1 cut(s) 127
AlwI GGATC 2 cut(s) 147, 160
AoxI GGCC 1 cut(s) 81
BalI TGGCCA 1 cut(s) 83
BamHI GGATCC 1 cut(s) 152
BanII GRGCYC 1 cut(s) 174
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
BmiI GGNNCC 1 cut(s) 154
BpuEI CTTGAG 1 cut(s) 158
BsaJI CCNNGG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 135
BseYI CCCAGC 1 cut(s) 167
BshFI GGCC 1 cut(s) 83
BsnI GGCC 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 174
Bsp143I GATC 1 cut(s) 152
BspANI GGCC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 154
BspPI GGATC 2 cut(s) 147, 160
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 1 cut(s) 152
BssT1I CCWWGG 1 cut(s) 135
BstDEI CTNAG 1 cut(s) 128
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
BsuRI GGCC 1 cut(s) 83
BtsIMutI CAGTG 1 cut(s) 116
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 2 cut(s) 33, 163
CviJI RGCY 5 cut(s) 31, 83, 127, 134, 172
CviKI_1 RGCY 5 cut(s) 31, 83, 127, 134, 172
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 128
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
EaeI YGGCCR 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 135
Eco24I GRGCYC 1 cut(s) 174
Eco57I CTGAAG 1 cut(s) 140
EcoT14I CCWWGG 1 cut(s) 135
EcoT38I GRGCYC 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 135
FalI AAGNNNNNCTT 2 cut(s) 140, 172
FriOI GRGCYC 1 cut(s) 174
GsaI CCCAGC 1 cut(s) 171
HaeIII GGCC 1 cut(s) 83
HinfI GANTC 1 cut(s) 71
Hpy188I TCNGA 3 cut(s) 52, 76, 93
Hpy188III TCNNGA 1 cut(s) 175
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 2 cut(s) 115, 142
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpyF3I CTNAG 1 cut(s) 128
Kzo9I GATC 1 cut(s) 152
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 153
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 2 cut(s) 67, 106
MflI RGATCY 1 cut(s) 152
MhlI GDGCHC 1 cut(s) 174
MlsI TGGCCA 1 cut(s) 83
MluNI TGGCCA 1 cut(s) 83
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 2 cut(s) 100, 155
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
Msp20I TGGCCA 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 1 cut(s) 152
NlaIV GGNNCC 1 cut(s) 154
PleI GAGTC 1 cut(s) 79
PpsI GAGTC 1 cut(s) 79
PspFI CCCAGC 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 154
PsuI RGATCY 1 cut(s) 152
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
Sau3AI GATC 1 cut(s) 152
SchI GAGTC 1 cut(s) 80
SduI GDGCHC 1 cut(s) 174
SetI ASST 3 cut(s) 19, 129, 166
SgeI CNNG 8 cut(s) 22, 26, 58, 64, 82, 148, 180, 187
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
StyI CCWWGG 1 cut(s) 135
TscAI CASTG 1 cut(s) 123
TspRI CASTG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.