Rh5AG389200

Translation machinery associated TMA7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0006696
Physical Location & Seq
Forward (+)
67373922 .. 67381194
7273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG389200.1

Sequence Viewer

Length: 195 bp
ATGTCGTCCAAGCAAGGTGGAAAGGCAAAACCTTTGAAGCAACCCAAGGCTGAGAAGAAGGAGTACGACGAGGATGATTTGGCCAAGCTTCAGAAGAAAAAGGATGAGGAAAAGGTTAGTAATCCTAAAAAGTCGTGCTCATTCCCAACAATGCTTCAGGTTCTCAAAAGGATGTTTTGCATGGCACTAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMA7

Protein Analysis

64

Amino Acids

7.35

Weight (kDa)

9.66

Isoelectric Point (pI)

63.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 39 3.5e-11 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 81
AcuI CTGAAG 2 cut(s) 74, 140
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 1 cut(s) 88
AluI AGCT 1 cut(s) 88
Alw21I GWGCWC 1 cut(s) 140
AoxI GGCC 1 cut(s) 81
BalI TGGCCA 1 cut(s) 83
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
Bbv12I GWGCWC 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 3 cut(s) 79, 109, 177
BseMII CTCAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 83
BsiHKAI GWGCWC 1 cut(s) 140
BsnI GGCC 1 cut(s) 83
Bsp1286I GDGCHC 1 cut(s) 140
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 45
BssT1I CCWWGG 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 3 cut(s) 79, 109, 177
BsuRI GGCC 1 cut(s) 83
BtsCI GGATG 3 cut(s) 79, 109, 177
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 1 cut(s) 33
CviAII CATG 1 cut(s) 181
CviJI RGCY 3 cut(s) 50, 83, 88
CviKI_1 RGCY 3 cut(s) 50, 83, 88
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 51
EaeI YGGCCR 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 45
Eco57I CTGAAG 2 cut(s) 74, 140
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 1 cut(s) 184
FaiI YATR 1 cut(s) 182
FatI CATG 1 cut(s) 180
FokI GGATG 3 cut(s) 86, 116, 184
HaeIII GGCC 1 cut(s) 83
Hin1II CATG 1 cut(s) 184
HindIII AAGCTT 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 93
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 180
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 1 cut(s) 184
LpnPI CCDG 1 cut(s) 143
MboII GAAGA 2 cut(s) 67, 106
MhlI GDGCHC 1 cut(s) 140
MlsI TGGCCA 1 cut(s) 83
MluNI TGGCCA 1 cut(s) 83
MnlI CCTC 2 cut(s) 64, 100
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
Msp20I TGGCCA 1 cut(s) 83
NlaIII CATG 1 cut(s) 184
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SduI GDGCHC 1 cut(s) 140
SetI ASST 5 cut(s) 19, 34, 90, 117, 162
SgeI CNNG 7 cut(s) 22, 26, 58, 82, 97, 147, 170
StyI CCWWGG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.