Rh2CG382800

Translation machinery associated TMA7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0006696
Physical Location & Seq
Forward (+)
52206253 .. 52215548
9296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG382800.1

Sequence Viewer

Length: 273 bp
ATGTCGTCCAAGCAAGGTGGAAAGGCGAAGCCTTTGAAGCAACCCAAGGCTGAGAAGAAGGAGTACGACGAGGATGATTTGGCCAAGCTTCAGAAGAAGAAGGATGAGGAAAAGTTAATAACAAATGGTGTTACTGAAGGTCACAAAAATTTTACATCGCAAAAGTTGAATCCTGGGGAAGCTTTCTTAAATGTTGTTACTTCTAAGAGTTTGGACATTGATGTTTTTATAATCCTTCACCAGATTTCAAAGTTGCATATGCTAATCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMA7

Protein Analysis

90

Amino Acids

10.16

Weight (kDa)

9.3

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 38 4.2e-12 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 230
AcoI YGGCCR 1 cut(s) 81
AcsI RAATTY 1 cut(s) 148
AcuI CTGAAG 2 cut(s) 74, 156
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 3 cut(s) 37, 169, 249
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 2 cut(s) 88, 182
AluI AGCT 2 cut(s) 88, 182
AoxI GGCC 1 cut(s) 81
ApoI RAATTY 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 230
BalI TGGCCA 1 cut(s) 83
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
BciT130I CCWGG 1 cut(s) 174
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BsaJI CCNNGG 2 cut(s) 45, 173
BseBI CCWGG 1 cut(s) 174
BseDI CCNNGG 2 cut(s) 45, 173
BseGI GGATG 2 cut(s) 79, 109
BseMII CTCAG 1 cut(s) 42
BshFI GGCC 1 cut(s) 83
BsnI GGCC 1 cut(s) 83
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 45, 173
BssT1I CCWWGG 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 174
BstDEI CTNAG 2 cut(s) 51, 204
BstF5I GGATG 2 cut(s) 79, 109
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BsuRI GGCC 1 cut(s) 83
BtgZI GCGATG 1 cut(s) 141
BtsCI GGATG 2 cut(s) 79, 109
Csp6I GTAC 1 cut(s) 64
CspCI CAANNNNNGTGG 1 cut(s) 33
CviJI RGCY 5 cut(s) 31, 50, 83, 88, 182
CviKI_1 RGCY 5 cut(s) 31, 50, 83, 88, 182
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 2 cut(s) 51, 204
EaeI YGGCCR 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 45
Eco57I CTGAAG 2 cut(s) 74, 156
EcoRII CCWGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaiI YATR 3 cut(s) 230, 258, 260
FauNDI CATATG 1 cut(s) 258
FokI GGATG 2 cut(s) 86, 116
HaeIII GGCC 1 cut(s) 83
HindIII AAGCTT 2 cut(s) 86, 180
HinfI GANTC 1 cut(s) 169
HphI GGTGA 1 cut(s) 230
Hpy188I TCNGA 1 cut(s) 93
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 4 cut(s) 52, 94, 131, 245
HpyCH4V TGCA 1 cut(s) 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 51, 204
LpnPI CCDG 3 cut(s) 159, 186, 254
MaeIII GTNAC 3 cut(s) 130, 140, 196
MboII GAAGA 3 cut(s) 67, 106, 109
MlsI TGGCCA 1 cut(s) 83
MluCI AATT 1 cut(s) 148
MluNI TGGCCA 1 cut(s) 83
MnlI CCTC 2 cut(s) 64, 100
Mox20I TGGCCA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 83
MseI TTAA 2 cut(s) 116, 188
Msp20I TGGCCA 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeI CATATG 1 cut(s) 258
NmuCI GTSAC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 169
PsiI TTATAA 1 cut(s) 230
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 2 cut(s) 116, 188
ScrFI CCNGG 1 cut(s) 174
SetI ASST 4 cut(s) 19, 90, 142, 184
SgeI CNNG 8 cut(s) 22, 26, 58, 82, 97, 185, 186, 253
Sse9I AATT 1 cut(s) 148
StyD4I CCNGG 1 cut(s) 172
StyI CCWWGG 1 cut(s) 45
TasI AATT 1 cut(s) 148
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 2 cut(s) 116, 188
Tru9I TTAA 2 cut(s) 116, 188
TseFI GTSAC 1 cut(s) 140
Tsp45I GTSAC 1 cut(s) 140
XapI RAATTY 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.