AT3G16040

Translation machinery associated TMA7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0006696
Physical Location & Seq
Forward (+)
5443081 .. 5443952
872 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G16040.1

Sequence Viewer

Length: 195 bp
ATGTCTTCCAAGCAAGGAGGGAAATTGAAGCCTTTGAAGCAGCCCAAGTCTGGTAAGAAGGAGTACGATGAGCACGATATGGAGTTAATGCAGAAAAAGAAGGATGAAGAGAAGGCACTTAAAGAACTCAGGGCCAAGGCTTCACAAAAAGGATCATTCGGAGGCTCAGGACTTAAGAAAAGTGGGAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMA7

Protein Analysis

64

Amino Acids

7.11

Weight (kDa)

9.95

Isoelectric Point (pI)

33.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TMA7 PF09072 3 - 64 6.7e-24 Translation machinery associated TMA7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 160
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 50
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 2 cut(s) 28, 37
Alw21I GWGCWC 1 cut(s) 75
AlwI GGATC 1 cut(s) 160
AoxI GGCC 1 cut(s) 132
ApeKI GCWGC 1 cut(s) 40
AspS9I GGNCC 1 cut(s) 132
Bbv12I GWGCWC 1 cut(s) 75
BbvI GCAGC 1 cut(s) 52
BfrI CTTAAG 1 cut(s) 173
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
BmgT120I GGNCC 1 cut(s) 132
Bpu10I CCTNAGC 1 cut(s) 166
BsaJI CCNNGG 1 cut(s) 135
Bsc4I CCNNNNNNNGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 50
BseMII CTCAG 2 cut(s) 142, 180
BseXI GCAGC 1 cut(s) 52
BshFI GGCC 1 cut(s) 134
BsiHKAI GWGCWC 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 50
BsnI GGCC 1 cut(s) 134
Bsp1286I GDGCHC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 152
BspANI GGCC 1 cut(s) 134
BspCNI CTCAG 2 cut(s) 141, 179
BspPI GGATC 1 cut(s) 160
BspTI CTTAAG 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 1 cut(s) 152
BssT1I CCWWGG 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 102
BstAFI CTTAAG 1 cut(s) 173
BstDEI CTNAG 2 cut(s) 128, 166
BstF5I GGATG 1 cut(s) 109
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstV1I GCAGC 1 cut(s) 52
BsuRI GGCC 1 cut(s) 134
BtsCI GGATG 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 132
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 5 cut(s) 31, 43, 134, 140, 165
CviKI_1 RGCY 5 cut(s) 31, 43, 134, 140, 165
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 2 cut(s) 128, 166
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FaiI YATR 1 cut(s) 80
Fnu4HI GCNGC 1 cut(s) 41
FokI GGATG 1 cut(s) 116
Fsp4HI GCNGC 1 cut(s) 41
GluI GCNGC 1 cut(s) 41
HaeIII GGCC 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 168
HpyAV CCTTC 3 cut(s) 52, 94, 106
HpyCH4V TGCA 1 cut(s) 91
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 128, 166
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 3 cut(s) 36, 115, 153
Lsp1109I GCAGC 1 cut(s) 52
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 1 cut(s) 23
MnlI CCTC 2 cut(s) 11, 155
MseI TTAA 3 cut(s) 86, 120, 174
MspCI CTTAAG 1 cut(s) 173
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 1 cut(s) 152
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PkrI GCNGC 1 cut(s) 42
PspPI GGNCC 1 cut(s) 132
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 3 cut(s) 86, 120, 174
SatI GCNGC 1 cut(s) 41
Sau3AI GATC 1 cut(s) 152
Sau96I GGNCC 1 cut(s) 132
SduI GDGCHC 1 cut(s) 75
SgeI CNNG 8 cut(s) 22, 26, 58, 63, 86, 142, 148, 180
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 1 cut(s) 23
StyI CCWWGG 1 cut(s) 135
TasI AATT 1 cut(s) 23
Tru1I TTAA 3 cut(s) 86, 120, 174
Tru9I TTAA 3 cut(s) 86, 120, 174
TseI GCWGC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 120
Vha464I CTTAAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.