AT1G66855

Possibly involved in carbohydrate binding

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Reverse (-)
24939550 .. 24940013
464 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G66855.1

Sequence Viewer

Length: 336 bp
ATGATTTCGCAATTGACACTAATCTTCTTTTTATCTCTCGTTGTAATCCAACCTTTTCATATTTTGGCCAAGACATGGTGTGTAGCAGCTGCATCAGCGACAGATACACAACTTCAAGCTAATATTGATTGGGCATGTAACGAAGGTAAAGTTGACTGTGTAAAAATTAATCCTGGTGGCGTTTGCTATGAACCAAATACTCTTACTAGCCATGCATCATTTGTGATGAATGATTACTATCGGAATCATGGGAGCATTGAAGAGGCATGTGAATTCAATCATACTGGTCAAATCATTAGTGGTGATCCAAGTTATCGTCGTTGTAGGTATTCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.41

Weight (kDa)

5.69

Isoelectric Point (pI)

36.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
X8 PF07983 25 - 96 3.7e-22 X8 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015912)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 75
AclWI GGATC 1 cut(s) 299
AcoI YGGCCR 1 cut(s) 66
AcsI RAATTY 1 cut(s) 272
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 3 cut(s) 116, 260, 277
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 2 cut(s) 89, 119
AluI AGCT 2 cut(s) 89, 119
AlwI GGATC 1 cut(s) 299
AoxI GGCC 1 cut(s) 66
ApeKI GCWGC 2 cut(s) 86, 89
ApoI RAATTY 1 cut(s) 272
AseI ATTAAT 1 cut(s) 168
AsuHPI GGTGA 1 cut(s) 314
BalI TGGCCA 1 cut(s) 68
BbvI GCAGC 2 cut(s) 76, 98
BciT130I CCWGG 1 cut(s) 174
BfaI CTAG 1 cut(s) 207
BisI GCNGC 2 cut(s) 87, 90
BlsI GCNGC 2 cut(s) 88, 91
Bme1390I CCNGG 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 2 cut(s) 101, 224
BsaBI GATNNNNATC 1 cut(s) 237
Bsc4I CCNNNNNNNGG 1 cut(s) 75
Bse1I ACTGG 1 cut(s) 289
Bse8I GATNNNNATC 1 cut(s) 237
BseBI CCWGG 1 cut(s) 174
BseJI GATNNNNATC 1 cut(s) 237
BseLI CCNNNNNNNGG 1 cut(s) 75
BseNI ACTGG 1 cut(s) 289
BseXI GCAGC 2 cut(s) 76, 98
BshFI GGCC 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 75
BsnI GGCC 1 cut(s) 68
Bsp143I GATC 1 cut(s) 304
BspANI GGCC 1 cut(s) 68
BspPI GGATC 1 cut(s) 299
BsrI ACTGG 1 cut(s) 289
BssMI GATC 1 cut(s) 304
Bst2UI CCWGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 158
Bst6I CTCTTC 1 cut(s) 255
BstKTI GATC 1 cut(s) 307
BstMBI GATC 1 cut(s) 304
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 174
BstNSI RCATGY 2 cut(s) 138, 270
BstSCI CCNGG 1 cut(s) 172
BstV1I GCAGC 2 cut(s) 76, 98
BsuRI GGCC 1 cut(s) 68
CviAII CATG 5 cut(s) 75, 135, 212, 248, 267
CviJI RGCY 4 cut(s) 68, 89, 119, 210
CviKI_1 RGCY 4 cut(s) 68, 89, 119, 210
DpnI GATC 1 cut(s) 306
DpnII GATC 1 cut(s) 304
EaeI YGGCCR 1 cut(s) 66
Eam1104I CTCTTC 1 cut(s) 255
EarI CTCTTC 1 cut(s) 255
EcoRI GAATTC 1 cut(s) 272
EcoRII CCWGG 1 cut(s) 172
EcoT22I ATGCAT 1 cut(s) 217
FaeI CATG 5 cut(s) 78, 138, 215, 251, 270
FaiI YATR 8 cut(s) 60, 76, 136, 189, 213, 249, 268, 282
FatI CATG 5 cut(s) 74, 134, 211, 247, 266
Fnu4HI GCNGC 2 cut(s) 87, 90
Fsp4HI GCNGC 2 cut(s) 87, 90
FspBI CTAG 1 cut(s) 207
GluI GCNGC 2 cut(s) 87, 90
HaeIII GGCC 1 cut(s) 68
Hin1II CATG 5 cut(s) 78, 138, 215, 251, 270
HincII GTYRAC 1 cut(s) 154
HindII GTYRAC 1 cut(s) 154
HinfI GANTC 1 cut(s) 244
HphI GGTGA 1 cut(s) 314
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 243
Hpy8I GTNNAC 1 cut(s) 154
Hpy99I CGWCG 1 cut(s) 321
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4V TGCA 2 cut(s) 92, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
Hsp92II CATG 5 cut(s) 78, 138, 215, 251, 270
Kzo9I GATC 1 cut(s) 304
LmnI GCTCC 1 cut(s) 252
LpnPI CCDG 3 cut(s) 159, 186, 270
Lsp1109I GCAGC 2 cut(s) 76, 98
LweI GCATC 2 cut(s) 101, 224
MaeI CTAG 1 cut(s) 207
MaeIII GTNAC 1 cut(s) 137
MalI GATC 1 cut(s) 306
MboI GATC 1 cut(s) 304
MboII GAAGA 2 cut(s) 16, 272
MfeI CAATTG 1 cut(s) 11
MlsI TGGCCA 1 cut(s) 68
MluCI AATT 3 cut(s) 11, 165, 272
MluNI TGGCCA 1 cut(s) 68
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 1 cut(s) 256
Mox20I TGGCCA 1 cut(s) 68
Mph1103I ATGCAT 1 cut(s) 217
MscI TGGCCA 1 cut(s) 68
MseI TTAA 1 cut(s) 168
Msp20I TGGCCA 1 cut(s) 68
MspA1I CMGCKG 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 174
MunI CAATTG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 1 cut(s) 304
NlaIII CATG 5 cut(s) 78, 138, 215, 251, 270
NsiI ATGCAT 1 cut(s) 217
NspI RCATGY 2 cut(s) 138, 270
PfeI GAWTC 1 cut(s) 244
PflMI CCANNNNNTGG 1 cut(s) 75
PkrI GCNGC 2 cut(s) 88, 91
PshBI ATTAAT 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PvuII CAGCTG 1 cut(s) 89
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 2 cut(s) 87, 90
Sau3AI GATC 1 cut(s) 304
ScrFI CCNGG 1 cut(s) 174
SetI ASST 5 cut(s) 55, 91, 121, 148, 329
SfaNI GCATC 2 cut(s) 101, 224
Sse9I AATT 3 cut(s) 11, 165, 272
SspI AATATT 1 cut(s) 124
SspMI CTAG 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 158
TasI AATT 3 cut(s) 11, 165, 272
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 2 cut(s) 86, 89
TspDTI ATGAA 3 cut(s) 47, 204, 242
Van91I CCANNNNNTGG 1 cut(s) 75
VspI ATTAAT 1 cut(s) 168
XapI RAATTY 1 cut(s) 272
XceI RCATGY 2 cut(s) 138, 270
XspI CTAG 1 cut(s) 207
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.