AT2G33705

F-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0015192
Physical Location & Seq
Forward (+)
14256151 .. 14256360
210 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G33705.1

Sequence Viewer

Length: 210 bp
ATGATGAAGACACGAGCTTGTTCGAATCCGATGAATGAAGGAGTAAACTTGGAACAGATCCCATACGATCTCGTATTGGAGATACTCTTGAAATTGTCGGCAAAGTCTATAGCGAGATTTCGTTGCGTATCAAAGCTATGGGATTCCACATTCCGCAGTCGATATTTCACTGAACTGCTCTTTATCATATCGTCTTCCATGCAAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_3

Protein Analysis

69

Amino Acids

8.04

Weight (kDa)

9.18

Isoelectric Point (pI)

44.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
F-box PF00646 17 - 57 2.1e-09 F-box domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 154
AclWI GGATC 1 cut(s) 52
AcsI RAATTY 1 cut(s) 204
AgsI TTSAA 1 cut(s) 91
AluBI AGCT 2 cut(s) 17, 136
AluI AGCT 2 cut(s) 17, 136
AlwI GGATC 1 cut(s) 52
ApoI RAATTY 1 cut(s) 204
AsuII TTCGAA 1 cut(s) 23
BauI CACGAG 1 cut(s) 12
BbsI GAAGAC 2 cut(s) 14, 186
BfmI CTRYAG 1 cut(s) 108
BpiI GAAGAC 2 cut(s) 14, 186
Bpu14I TTCGAA 1 cut(s) 23
Bsp119I TTCGAA 1 cut(s) 23
Bsp143I GATC 2 cut(s) 57, 67
BspACI CCGC 1 cut(s) 154
BspPI GGATC 1 cut(s) 52
BspT104I TTCGAA 1 cut(s) 23
BssMI GATC 2 cut(s) 57, 67
BssSI CACGAG 1 cut(s) 12
Bst2BI CACGAG 1 cut(s) 12
BstBI TTCGAA 1 cut(s) 23
BstKTI GATC 2 cut(s) 60, 70
BstMBI GATC 2 cut(s) 57, 67
BstSFI CTRYAG 1 cut(s) 108
BstV2I GAAGAC 2 cut(s) 14, 186
BstX2I RGATCY 1 cut(s) 57
BstYI RGATCY 1 cut(s) 57
BtsIMutI CAGTG 1 cut(s) 168
CviAII CATG 1 cut(s) 199
CviJI RGCY 2 cut(s) 17, 136
CviKI_1 RGCY 2 cut(s) 17, 136
DpnI GATC 2 cut(s) 59, 69
DpnII GATC 2 cut(s) 57, 67
FaeI CATG 1 cut(s) 202
FaiI YATR 5 cut(s) 64, 110, 139, 188, 200
FatI CATG 1 cut(s) 198
Hin1II CATG 1 cut(s) 202
HinfI GANTC 2 cut(s) 25, 143
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 30
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 32
HpyCH4V TGCA 1 cut(s) 202
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 2 cut(s) 57, 67
MalI GATC 2 cut(s) 59, 69
MboI GATC 2 cut(s) 57, 67
MboII GAAGA 2 cut(s) 19, 186
MflI RGATCY 1 cut(s) 57
MluCI AATT 2 cut(s) 92, 204
NdeII GATC 2 cut(s) 57, 67
NlaIII CATG 1 cut(s) 202
NspV TTCGAA 1 cut(s) 23
PfeI GAWTC 2 cut(s) 25, 143
PsuI RGATCY 1 cut(s) 57
Sau3AI GATC 2 cut(s) 57, 67
SetI ASST 2 cut(s) 19, 138
SfcI CTRYAG 1 cut(s) 108
SfuI TTCGAA 1 cut(s) 23
SgeI CNNG 7 cut(s) 24, 26, 30, 61, 83, 100, 126
Sse9I AATT 2 cut(s) 92, 204
SsiI CCGC 1 cut(s) 154
TaqI TCGA 2 cut(s) 23, 160
TasI AATT 2 cut(s) 92, 204
TfiI GAWTC 2 cut(s) 25, 143
TscAI CASTG 1 cut(s) 175
TspDTI ATGAA 3 cut(s) 20, 47, 51
TspRI CASTG 1 cut(s) 175
XapI RAATTY 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.