AT3G19615

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
6814966 .. 6815403
438 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G19615.1

Sequence Viewer

Length: 282 bp
ATGGAGGGGTTAATTCCATATCTGATTCATGCTATCAAGAAAGACCACAAGCCTGATCATCAGAGGTATCGATCGATATCTGTGGGATCGAGCCGAAGCTATCGACCTTTAATGATGGGACAAGACGGCTCTTCTTCAATGCAGGGATCTTCTCACCGTCGAACTAGATCAGACTATAATCCACATGTTATAATGGATAAGTTTGATCAGAGATCATCAGGTTTTGGTCAAGAATTTGTGAATAAAGATTCTTCTTCTCAGAAAATAGCAACAAAGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.6

Weight (kDa)

9.91

Isoelectric Point (pI)

58.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 191
AclWI GGATC 2 cut(s) 94, 154
AcsI RAATTY 1 cut(s) 233
AflIII ACRYGT 1 cut(s) 184
AgsI TTSAA 1 cut(s) 138
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
AlwI GGATC 2 cut(s) 94, 154
ApoI RAATTY 1 cut(s) 233
AsuHPI GGTGA 1 cut(s) 146
BccI CCATC 1 cut(s) 109
BceAI ACGGC 1 cut(s) 142
BclI TGATCA 2 cut(s) 55, 205
BfaI CTAG 1 cut(s) 165
Bsa29I ATCGAT 2 cut(s) 70, 74
BsaBI GATNNNNATC 1 cut(s) 76
Bse8I GATNNNNATC 1 cut(s) 76
BseCI ATCGAT 2 cut(s) 70, 74
BseJI GATNNNNATC 1 cut(s) 76
BseMII CTCAG 1 cut(s) 272
Bsh1285I CGRYCG 1 cut(s) 74
BshVI ATCGAT 2 cut(s) 70, 74
BsiEI CGRYCG 1 cut(s) 74
BslFI GGGAC 1 cut(s) 132
BsmFI GGGAC 1 cut(s) 132
Bsp143I GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
BspCNI CTCAG 1 cut(s) 271
BspDI ATCGAT 2 cut(s) 70, 74
BspPI GGATC 2 cut(s) 94, 154
BspQI GCTCTTC 1 cut(s) 136
BssMI GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
Bst4CI ACNGT 1 cut(s) 158
Bst6I CTCTTC 1 cut(s) 136
BstDEI CTNAG 2 cut(s) 258, 279
BstKTI GATC 7 cut(s) 58, 74, 89, 149, 170, 208, 215
BstMBI GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
BstMCI CGRYCG 1 cut(s) 74
BstNSI RCATGY 1 cut(s) 188
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
Bsu15I ATCGAT 2 cut(s) 70, 74
BsuTUI ATCGAT 2 cut(s) 70, 74
ClaI ATCGAT 2 cut(s) 70, 74
CviAII CATG 2 cut(s) 29, 185
CviJI RGCY 4 cut(s) 52, 93, 99, 129
CviKI_1 RGCY 4 cut(s) 52, 93, 99, 129
DdeI CTNAG 2 cut(s) 258, 279
DpnI GATC 7 cut(s) 57, 73, 88, 148, 169, 207, 214
DpnII GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
Eam1104I CTCTTC 1 cut(s) 136
EarI CTCTTC 1 cut(s) 136
Eco32I GATATC 1 cut(s) 78
EcoRV GATATC 1 cut(s) 78
FaeI CATG 2 cut(s) 32, 188
FaiI YATR 5 cut(s) 19, 30, 177, 186, 191
FaqI GGGAC 1 cut(s) 132
FatI CATG 2 cut(s) 28, 184
FbaI TGATCA 2 cut(s) 55, 205
FspBI CTAG 1 cut(s) 165
Hin1II CATG 2 cut(s) 32, 188
HinfI GANTC 2 cut(s) 25, 248
HphI GGTGA 1 cut(s) 146
Hpy188I TCNGA 5 cut(s) 24, 63, 172, 210, 261
Hpy188III TCNNGA 2 cut(s) 37, 230
Hpy99I CGWCG 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 142
HpyF3I CTNAG 2 cut(s) 258, 279
Hsp92II CATG 2 cut(s) 32, 188
Ksp22I TGATCA 2 cut(s) 55, 205
Kzo9I GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
LguI GCTCTTC 1 cut(s) 136
LpnPI CCDG 3 cut(s) 66, 128, 204
MaeI CTAG 1 cut(s) 165
MalI GATC 7 cut(s) 57, 73, 88, 148, 169, 207, 214
MboI GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
MboII GAAGA 5 cut(s) 123, 126, 141, 243, 246
MflI RGATCY 1 cut(s) 146
MluCI AATT 2 cut(s) 12, 233
MnlI CCTC 1 cut(s) 57
MseI TTAA 2 cut(s) 11, 110
NdeII GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
NlaIII CATG 2 cut(s) 32, 188
NspI RCATGY 1 cut(s) 188
PciI ACATGT 1 cut(s) 184
PciSI GCTCTTC 1 cut(s) 136
PfeI GAWTC 2 cut(s) 25, 248
Ple19I CGATCG 1 cut(s) 74
PscI ACATGT 1 cut(s) 184
PsiI TTATAA 1 cut(s) 191
PsuI RGATCY 1 cut(s) 146
PvuI CGATCG 1 cut(s) 74
SapI GCTCTTC 1 cut(s) 136
SaqAI TTAA 2 cut(s) 11, 110
Sau3AI GATC 7 cut(s) 55, 71, 86, 146, 167, 205, 212
SetI ASST 4 cut(s) 68, 101, 109, 223
Sse9I AATT 2 cut(s) 12, 233
SspMI CTAG 1 cut(s) 165
TaaI ACNGT 1 cut(s) 158
TaqI TCGA 5 cut(s) 70, 74, 89, 103, 160
TasI AATT 2 cut(s) 12, 233
TfiI GAWTC 2 cut(s) 25, 248
Tru1I TTAA 2 cut(s) 11, 110
Tru9I TTAA 2 cut(s) 11, 110
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 233
XceI RCATGY 1 cut(s) 188
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.