AT3G29130

Uncharacterized conserved protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0009507
Physical Location & Seq
Reverse (-)
11099603 .. 11104073
4471 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G29130.2

Sequence Viewer

Length: 360 bp
ATGGAAGAAACCATAAGAGCAGCTTCACAAGAAGTGTCTAACGAATTCAAAACTCTTGTTAAAGTAGAAGATTTGAATTCTCTTAGACATTTGCAGCATCTCATATTGGGGAGGCTACAGGATAGCAATGCAGTTCTCTCCCATTACAACGAATTTGCAGAGAATTGCTTTAGTGATGTATCATTGGAATTCGCTAGAAGTACCCGTCTTTTGAAGTCGATGAAAGCAGACCTCGATTACATCTTCTTGAAACTAAGGAGCATTAAAAGTAAGATTCTGGCTACGTATCCAGACGCATTTCCAGATGATTCTACTAGTGATGCTTTTGATCGACGGCCCGATCTCGAGTTGCCTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KxDL

Protein Analysis

119

Amino Acids

13.68

Weight (kDa)

5.14

Isoelectric Point (pI)

51.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KxDL PF10241 65 - 149 2.2e-22 Uncharacterized conserved protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 44, 76, 152, 188
AfaI GTAC 1 cut(s) 202
AgsI TTSAA 4 cut(s) 49, 76, 214, 250
AhlI ACTAGT 1 cut(s) 314
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Ama87I CYCGRG 1 cut(s) 344
AoxI GGCC 1 cut(s) 335
ApeKI GCWGC 2 cut(s) 20, 94
ApoI RAATTY 4 cut(s) 44, 76, 152, 188
AspS9I GGNCC 1 cut(s) 336
AvaI CYCGRG 1 cut(s) 344
BbvI GCAGC 2 cut(s) 32, 106
BceAI ACGGC 1 cut(s) 350
BciVI GTATCC 1 cut(s) 297
BcuI ACTAGT 1 cut(s) 314
BfaI CTAG 2 cut(s) 195, 315
BfmI CTRYAG 1 cut(s) 116
BfuI GTATCC 1 cut(s) 297
BisI GCNGC 2 cut(s) 21, 95
BlsI GCNGC 2 cut(s) 22, 96
BmeT110I CYCGRG 1 cut(s) 344
BmgT120I GGNCC 1 cut(s) 336
BmsI GCATC 2 cut(s) 106, 310
BsaAI YACGTR 1 cut(s) 285
Bse3DI GCAATG 1 cut(s) 133
BseMI GCAATG 1 cut(s) 133
BseXI GCAGC 2 cut(s) 32, 106
BshFI GGCC 1 cut(s) 337
BsiHKCI CYCGRG 1 cut(s) 344
BsnI GGCC 1 cut(s) 337
BsoBI CYCGRG 1 cut(s) 344
Bsp143I GATC 2 cut(s) 328, 340
BspANI GGCC 1 cut(s) 337
BsrDI GCAATG 1 cut(s) 133
BssMI GATC 2 cut(s) 328, 340
BstBAI YACGTR 1 cut(s) 285
BstDEI CTNAG 2 cut(s) 83, 254
BstKTI GATC 2 cut(s) 331, 343
BstMBI GATC 2 cut(s) 328, 340
BstSFI CTRYAG 1 cut(s) 116
BstSNI TACGTA 1 cut(s) 285
BstV1I GCAGC 2 cut(s) 32, 106
BsuI GTATCC 1 cut(s) 297
BsuRI GGCC 1 cut(s) 337
Cfr13I GGNCC 1 cut(s) 336
CseI GACGC 1 cut(s) 302
Csp6I GTAC 1 cut(s) 201
CviJI RGCY 4 cut(s) 23, 115, 281, 337
CviKI_1 RGCY 4 cut(s) 23, 115, 281, 337
CviQI GTAC 1 cut(s) 201
DdeI CTNAG 2 cut(s) 83, 254
DpnI GATC 2 cut(s) 330, 342
DpnII GATC 2 cut(s) 328, 340
Eco105I TACGTA 1 cut(s) 285
Eco88I CYCGRG 1 cut(s) 344
EcoRI GAATTC 3 cut(s) 44, 76, 188
FaiI YATR 2 cut(s) 14, 104
FalI AAGNNNNNCTT 2 cut(s) 7, 39
Fnu4HI GCNGC 2 cut(s) 21, 95
Fsp4HI GCNGC 2 cut(s) 21, 95
FspBI CTAG 2 cut(s) 195, 315
GluI GCNGC 2 cut(s) 21, 95
HaeIII GGCC 1 cut(s) 337
HgaI GACGC 1 cut(s) 302
HinfI GANTC 2 cut(s) 274, 308
Hpy188III TCNNGA 4 cut(s) 247, 290, 302, 344
Hpy99I CGWCG 1 cut(s) 336
HpyCH4IV ACGT 1 cut(s) 284
HpyCH4V TGCA 3 cut(s) 94, 131, 158
HpyF3I CTNAG 2 cut(s) 83, 254
HpySE526I ACGT 1 cut(s) 284
Kzo9I GATC 2 cut(s) 328, 340
LmnI GCTCC 1 cut(s) 258
LpnPI CCDG 4 cut(s) 104, 263, 303, 315
Lsp1109I GCAGC 2 cut(s) 32, 106
LweI GCATC 2 cut(s) 106, 310
MaeI CTAG 2 cut(s) 195, 315
MaeII ACGT 1 cut(s) 284
MalI GATC 2 cut(s) 330, 342
MboI GATC 2 cut(s) 328, 340
MboII GAAGA 3 cut(s) 17, 80, 235
MluCI AATT 5 cut(s) 44, 76, 152, 163, 188
MnlI CCTC 2 cut(s) 105, 242
MseI TTAA 2 cut(s) 60, 264
NdeII GATC 2 cut(s) 328, 340
PaeR7I CTCGAG 1 cut(s) 344
PfeI GAWTC 2 cut(s) 274, 308
PkrI GCNGC 2 cut(s) 22, 96
Ppu21I YACGTR 1 cut(s) 285
PspPI GGNCC 1 cut(s) 336
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
SaqAI TTAA 2 cut(s) 60, 264
SatI GCNGC 2 cut(s) 21, 95
Sau3AI GATC 2 cut(s) 328, 340
Sau96I GGNCC 1 cut(s) 336
SetI ASST 3 cut(s) 25, 234, 287
SfaNI GCATC 2 cut(s) 106, 310
SfcI CTRYAG 1 cut(s) 116
Sfr274I CTCGAG 1 cut(s) 344
SlaI CTCGAG 1 cut(s) 344
SmlI CTYRAG 1 cut(s) 344
SmoI CTYRAG 1 cut(s) 344
SnaBI TACGTA 1 cut(s) 285
SpeI ACTAGT 1 cut(s) 314
Sse9I AATT 5 cut(s) 44, 76, 152, 163, 188
SspMI CTAG 2 cut(s) 195, 315
TaiI ACGT 1 cut(s) 287
TaqI TCGA 4 cut(s) 218, 234, 331, 345
TasI AATT 5 cut(s) 44, 76, 152, 163, 188
TfiI GAWTC 2 cut(s) 274, 308
Tru1I TTAA 2 cut(s) 60, 264
Tru9I TTAA 2 cut(s) 60, 264
TseI GCWGC 2 cut(s) 20, 94
TspDTI ATGAA 1 cut(s) 236
XapI RAATTY 4 cut(s) 44, 76, 152, 188
XhoI CTCGAG 1 cut(s) 344
XspI CTAG 2 cut(s) 195, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.