Rmu_sc0001878.1_g000012

kxDL motif-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001878.1
OG0009507
Physical Location & Seq
Forward (+)
63018 .. 65085
2068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001878.1_g000012.1.cds

Sequence Viewer

Length: 372 bp
atggagcagattgagaaagaagcgattaaggaggcatcagtggaggtatcaaatgaattcaaaaccctaatcgatgcccaggatttggattccctcaaacaactgcagcacctcatattggggaggttgcaagatggcaatgcggtcctgtcacactttaatgaagtttcagagaactgctttgctgaggtttctggggatttctctaaaaacacacgccttttgcggtctatgaagtctgatcttgaatacatatttcagaagttaaggagcatgaagtcaagaattttggctacctatccagatgcatttccggatgactcgaaacaagaagtacatgaccaaagaccagaccttgaaatgccactgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KxDL

Protein Analysis

123

Amino Acids

14.14

Weight (kDa)

4.82

Isoelectric Point (pI)

48.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 85
AccIII TCCGGA 1 cut(s) 313
AciI CCGC 2 cut(s) 143, 226
AcsI RAATTY 2 cut(s) 56, 285
AfaI GTAC 1 cut(s) 336
AfiI CCNNNNNNNGG 2 cut(s) 85, 118
AgsI TTSAA 3 cut(s) 61, 248, 359
AjnI CCWGG 1 cut(s) 78
Aor13HI TCCGGA 1 cut(s) 313
ApeKI GCWGC 1 cut(s) 106
ApoI RAATTY 2 cut(s) 56, 285
AspS9I GGNCC 1 cut(s) 145
AvaII GGWCC 1 cut(s) 145
BbvCI CCTCAGC 1 cut(s) 186
BbvI GCAGC 1 cut(s) 118
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 80
BfmI CTRYAG 1 cut(s) 104
BisI GCNGC 1 cut(s) 107
BlsI GCNGC 1 cut(s) 108
Bme1390I CCNGG 1 cut(s) 80
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 145
BmrFI CCNGG 1 cut(s) 80
BmsI GCATC 3 cut(s) 44, 64, 295
Bpu10I CCTNAGC 1 cut(s) 186
Bsa29I ATCGAT 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 78
BsaWI WCCGGW 1 cut(s) 313
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 118
Bse3DI GCAATG 1 cut(s) 145
BseAI TCCGGA 1 cut(s) 313
BseBI CCWGG 1 cut(s) 80
BseCI ATCGAT 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 322
BseLI CCNNNNNNNGG 2 cut(s) 85, 118
BseMI GCAATG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 177
BseXI GCAGC 1 cut(s) 118
BshVI ATCGAT 1 cut(s) 72
BsiSI CCGG 1 cut(s) 314
BslI CCNNNNNNNGG 2 cut(s) 85, 118
Bsp13I TCCGGA 1 cut(s) 313
Bsp143I GATC 1 cut(s) 241
BspACI CCGC 2 cut(s) 143, 226
BspCNI CTCAG 1 cut(s) 178
BspDI ATCGAT 1 cut(s) 72
BspEI TCCGGA 1 cut(s) 313
BspMAI CTGCAG 1 cut(s) 108
BsrDI GCAATG 1 cut(s) 145
BssECI CCNNGG 1 cut(s) 78
BssMI GATC 1 cut(s) 241
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 369
BstDEI CTNAG 1 cut(s) 186
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 104
BstV1I GCAGC 1 cut(s) 118
Bsu15I ATCGAT 1 cut(s) 72
BsuTUI ATCGAT 1 cut(s) 72
BtsCI GGATG 1 cut(s) 322
BtsIMutI CAGTG 2 cut(s) 45, 365
Cfr13I GGNCC 1 cut(s) 145
ClaI ATCGAT 1 cut(s) 72
Csp6I GTAC 1 cut(s) 335
CviAII CATG 2 cut(s) 274, 338
CviJI RGCY 1 cut(s) 293
CviKI_1 RGCY 1 cut(s) 293
CviQI GTAC 1 cut(s) 335
DdeI CTNAG 1 cut(s) 186
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
Eco47I GGWCC 1 cut(s) 145
EcoRI GAATTC 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 78
EcoT22I ATGCAT 1 cut(s) 310
FaeI CATG 2 cut(s) 277, 341
FaiI YATR 5 cut(s) 116, 233, 254, 275, 339
FatI CATG 2 cut(s) 273, 337
Fnu4HI GCNGC 1 cut(s) 107
FokI GGATG 1 cut(s) 329
Fsp4HI GCNGC 1 cut(s) 107
GluI GCNGC 1 cut(s) 107
HapII CCGG 1 cut(s) 314
Hin1II CATG 2 cut(s) 277, 341
HinfI GANTC 2 cut(s) 89, 320
HpaII CCGG 1 cut(s) 314
Hpy188I TCNGA 3 cut(s) 172, 241, 261
Hpy188III TCNNGA 4 cut(s) 245, 282, 302, 314
HpyCH4III ACNGT 1 cut(s) 369
HpyCH4V TGCA 3 cut(s) 106, 130, 308
HpyF3I CTNAG 1 cut(s) 186
Hsp92II CATG 2 cut(s) 277, 341
Kpn2I TCCGGA 1 cut(s) 313
Kzo9I GATC 1 cut(s) 241
LmnI GCTCC 2 cut(s) 4, 270
LpnPI CCDG 7 cut(s) 65, 92, 161, 180, 315, 327, 363
Lsp1109I GCAGC 1 cut(s) 118
LweI GCATC 3 cut(s) 44, 64, 295
MaeIII GTNAC 1 cut(s) 150
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MluCI AATT 2 cut(s) 56, 285
MlyI GAGTC 1 cut(s) 314
MnlI CCTC 6 cut(s) 25, 37, 104, 117, 122, 181
Mph1103I ATGCAT 1 cut(s) 310
MroI TCCGGA 1 cut(s) 313
MseI TTAA 3 cut(s) 27, 159, 266
MslI CAYNNNNRTG 1 cut(s) 159
MspI CCGG 1 cut(s) 314
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
NdeII GATC 1 cut(s) 241
NlaIII CATG 2 cut(s) 277, 341
NmuCI GTSAC 1 cut(s) 150
NsiI ATGCAT 1 cut(s) 310
PfeI GAWTC 1 cut(s) 89
PflMI CCANNNNNTGG 1 cut(s) 85
PkrI GCNGC 1 cut(s) 108
PleI GAGTC 1 cut(s) 314
PpsI GAGTC 1 cut(s) 314
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspPI GGNCC 1 cut(s) 145
PstI CTGCAG 1 cut(s) 108
RsaI GTAC 1 cut(s) 336
RsaNI GTAC 1 cut(s) 335
RseI CAYNNNNRTG 1 cut(s) 159
SaqAI TTAA 3 cut(s) 27, 159, 266
SatI GCNGC 1 cut(s) 107
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 145
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 1 cut(s) 80
SetI ASST 6 cut(s) 48, 114, 128, 192, 299, 357
SfaNI GCATC 3 cut(s) 44, 64, 295
SfcI CTRYAG 1 cut(s) 104
SinI GGWCC 1 cut(s) 145
SmiMI CAYNNNNRTG 1 cut(s) 159
Sse9I AATT 2 cut(s) 56, 285
SsiI CCGC 2 cut(s) 143, 226
StyD4I CCNGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 369
TaqI TCGA 2 cut(s) 72, 323
TasI AATT 2 cut(s) 56, 285
TatI WGTACW 1 cut(s) 334
TfiI GAWTC 1 cut(s) 89
Tru1I TTAA 3 cut(s) 27, 159, 266
Tru9I TTAA 3 cut(s) 27, 159, 266
TscAI CASTG 2 cut(s) 45, 372
TseFI GTSAC 1 cut(s) 150
TseI GCWGC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 150
TspDTI ATGAA 4 cut(s) 69, 177, 248, 290
TspRI CASTG 2 cut(s) 45, 372
Van91I CCANNNNNTGG 1 cut(s) 85
VpaK11BI GGWCC 1 cut(s) 145
XapI RAATTY 2 cut(s) 56, 285
Zsp2I ATGCAT 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.