AT4G24920

protein transport protein SEC61 gamma subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0003532
Physical Location & Seq
Reverse (-)
12819164 .. 12820968
1805 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G24920.1

Sequence Viewer

Length: 210 bp
ATGGACGCCATTGATTCCGTCGTGGATCCTCTTAGAGACTTTGCCAAGGACAGCATTCGCCTCGTTAAGCGTTGTCATAAGCCAGATCGCAAAGAATTCACGAAAGTTGCAGTCCGTACAGCAATCGGGTTCGTAGTAATGGGATTCGTGGGATTCTTTGTGAAGCTCATCTTTATTCCAATCAACAACATCATCGTCGGTGCTACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03060 ko04141 ko04145 ko05110 map03060 map04141 map04145 map05110
Pfam Domains
Protein Families
SecE

Protein Analysis

69

Amino Acids

7.74

Weight (kDa)

9.74

Isoelectric Point (pI)

22.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SecE PF00584 13 - 65 6.5e-15 SecE/Sec61-gamma subunits of protein translocation complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 20, 33
AcsI RAATTY 1 cut(s) 95
AcyI GRCGYC 1 cut(s) 6
AfaI GTAC 1 cut(s) 118
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
Alw26I GTCTC 1 cut(s) 30
AlwI GGATC 2 cut(s) 20, 33
ApoI RAATTY 1 cut(s) 95
BamHI GGATCC 1 cut(s) 25
BcgI CGANNNNNNTGC 2 cut(s) 43, 77
BcoDI GTCTC 1 cut(s) 30
BmiI GGNNCC 1 cut(s) 27
BsaHI GRCGYC 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 45
BsmAI GTCTC 1 cut(s) 30
BsmI GAATGC 1 cut(s) 54
Bsp143I GATC 2 cut(s) 25, 85
BspLI GGNNCC 1 cut(s) 27
BspPI GGATC 2 cut(s) 20, 33
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 2 cut(s) 25, 85
BssNI GRCGYC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 45
BstACI GRCGYC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 32, 207
BstKTI GATC 2 cut(s) 28, 88
BstMAI GTCTC 1 cut(s) 30
BstMBI GATC 2 cut(s) 25, 85
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 117
CviJI RGCY 2 cut(s) 82, 166
CviKI_1 RGCY 2 cut(s) 82, 166
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 2 cut(s) 32, 207
DpnI GATC 2 cut(s) 27, 87
DpnII GATC 2 cut(s) 25, 85
Eco130I CCWWGG 1 cut(s) 45
EcoRI GAATTC 1 cut(s) 95
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaiI YATR 1 cut(s) 78
FalI AAGNNNNNCTT 2 cut(s) 155, 187
HgaI GACGC 1 cut(s) 14
Hin1I GRCGYC 1 cut(s) 6
HinfI GANTC 3 cut(s) 14, 144, 153
Hpy188III TCNNGA 1 cut(s) 100
Hpy99I CGWCG 2 cut(s) 23, 200
HpyCH4V TGCA 1 cut(s) 110
HpyF3I CTNAG 2 cut(s) 32, 207
Hsp92I GRCGYC 1 cut(s) 6
Kzo9I GATC 2 cut(s) 25, 85
LpnPI CCDG 1 cut(s) 96
MalI GATC 2 cut(s) 27, 87
MboI GATC 2 cut(s) 25, 85
MflI RGATCY 1 cut(s) 25
MluCI AATT 1 cut(s) 95
MnlI CCTC 2 cut(s) 39, 71
MseI TTAA 1 cut(s) 66
Mva1269I GAATGC 1 cut(s) 54
NdeII GATC 2 cut(s) 25, 85
NlaIV GGNNCC 1 cut(s) 27
PctI GAATGC 1 cut(s) 54
PfeI GAWTC 3 cut(s) 14, 144, 153
PspN4I GGNNCC 1 cut(s) 27
PsuI RGATCY 1 cut(s) 25
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
SaqAI TTAA 1 cut(s) 66
Sau3AI GATC 2 cut(s) 25, 85
SetI ASST 1 cut(s) 168
SgeI CNNG 7 cut(s) 34, 58, 74, 95, 112, 139, 160
Sse9I AATT 1 cut(s) 95
StyI CCWWGG 1 cut(s) 45
TasI AATT 1 cut(s) 95
TfiI GAWTC 3 cut(s) 14, 144, 153
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TspGWI ACGGA 2 cut(s) 7, 104
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.