AT5G50460

protein transport protein SEC61 gamma subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0003532
Physical Location & Seq
Reverse (-)
20551132 .. 20552670
1539 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G50460.1

Sequence Viewer

Length: 210 bp
ATGGACGCCATTGATTCCGTCGTTGATCCTCTCAGAGACTTCGCTAAGGATAGTATTCGTCTCGTCAAGCGTTGCCACAAGCCAGATCGCAAAGAATTCACGAAAGTTGCAGTTCGTACCGCGATTGGGTTTGTGGTAATGGGATTCGTTGGCTTCTTTGTGAAGCTAATCTTCATTCCGATCAACAACATCATCGTCGGTGCCACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03060 ko04141 ko04145 ko05110 map03060 map04141 map04145 map05110
Pfam Domains
Protein Families
SecE

Protein Analysis

69

Amino Acids

7.74

Weight (kDa)

9.74

Isoelectric Point (pI)

22.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SecE PF00584 13 - 65 6.5e-15 SecE/Sec61-gamma subunits of protein translocation complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 200
AccII CGCG 1 cut(s) 122
AciI CCGC 1 cut(s) 120
AclWI GGATC 1 cut(s) 20
AcsI RAATTY 1 cut(s) 95
AcyI GRCGYC 1 cut(s) 6
AfaI GTAC 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 126
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
Alw26I GTCTC 2 cut(s) 30, 65
AlwI GGATC 1 cut(s) 20
ApoI RAATTY 1 cut(s) 95
BanI GGYRCC 1 cut(s) 200
BcoDI GTCTC 2 cut(s) 30, 65
BmiI GGNNCC 1 cut(s) 202
Bpu10I CCTNAGC 1 cut(s) 45
BsaHI GRCGYC 1 cut(s) 6
Bsc4I CCNNNNNNNGG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMII CTCAG 1 cut(s) 46
Bsh1236I CGCG 1 cut(s) 122
BshNI GGYRCC 1 cut(s) 200
BslI CCNNNNNNNGG 1 cut(s) 126
BsmAI GTCTC 2 cut(s) 30, 65
BsmBI CGTCTC 1 cut(s) 65
Bsp143I GATC 3 cut(s) 25, 85, 180
BspACI CCGC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 45
BspFNI CGCG 1 cut(s) 122
BspLI GGNNCC 1 cut(s) 202
BspPI GGATC 1 cut(s) 20
BspT107I GGYRCC 1 cut(s) 200
BssMI GATC 3 cut(s) 25, 85, 180
BssNI GRCGYC 1 cut(s) 6
BstACI GRCGYC 1 cut(s) 6
BstDEI CTNAG 3 cut(s) 32, 45, 207
BstFNI CGCG 1 cut(s) 122
BstKTI GATC 3 cut(s) 28, 88, 183
BstMAI GTCTC 2 cut(s) 30, 65
BstMBI GATC 3 cut(s) 25, 85, 180
BstUI CGCG 1 cut(s) 122
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 117
CviJI RGCY 3 cut(s) 82, 153, 166
CviKI_1 RGCY 3 cut(s) 82, 153, 166
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 3 cut(s) 32, 45, 207
DpnI GATC 3 cut(s) 27, 87, 182
DpnII GATC 3 cut(s) 25, 85, 180
EcoRI GAATTC 1 cut(s) 95
Esp3I CGTCTC 1 cut(s) 65
FalI AAGNNNNNCTT 2 cut(s) 155, 187
HgaI GACGC 1 cut(s) 14
Hin1I GRCGYC 1 cut(s) 6
HinfI GANTC 2 cut(s) 14, 144
Hpy188I TCNGA 2 cut(s) 35, 180
Hpy188III TCNNGA 1 cut(s) 100
Hpy99I CGWCG 2 cut(s) 23, 200
HpyCH4V TGCA 1 cut(s) 110
HpyF3I CTNAG 3 cut(s) 32, 45, 207
Hsp92I GRCGYC 1 cut(s) 6
Kzo9I GATC 3 cut(s) 25, 85, 180
LpnPI CCDG 1 cut(s) 96
MalI GATC 3 cut(s) 27, 87, 182
MboI GATC 3 cut(s) 25, 85, 180
MboII GAAGA 1 cut(s) 163
MluCI AATT 1 cut(s) 95
MnlI CCTC 1 cut(s) 39
MvnI CGCG 1 cut(s) 122
NdeII GATC 3 cut(s) 25, 85, 180
NlaIV GGNNCC 1 cut(s) 202
PfeI GAWTC 2 cut(s) 14, 144
PspN4I GGNNCC 1 cut(s) 202
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
Sau3AI GATC 3 cut(s) 25, 85, 180
SetI ASST 1 cut(s) 168
SgeI CNNG 6 cut(s) 74, 79, 91, 95, 112, 133
Sse9I AATT 1 cut(s) 95
SsiI CCGC 1 cut(s) 120
TasI AATT 1 cut(s) 95
TfiI GAWTC 2 cut(s) 14, 144
TspDTI ATGAA 1 cut(s) 163
TspGWI ACGGA 1 cut(s) 7
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.