Rw7G009290

Protein transport protein Sec61 subunit

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Forward (+)
8739737 .. 8740552
816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G009290.1

Sequence Viewer

Length: 210 bp
ATGGACGCCATTGACTCAGTTGTGGATCCTCTCAGAGAGTTCGCTAAGGACAGCGCTCGGCTCGTCAAGAGGTGCCACAAGCCCGATCGCAAAGAATTCTCAAAGGTGGCGTTGCGTACAGCCATCGGGTTTGTTGTGATGGGATTCGTTGGGTTTTTCGTGAAGCTGATCTTCATTCCCATCAACAACATCATCGTCGGATCTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.72

Weight (kDa)

9.74

Isoelectric Point (pI)

27.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SecE PF00584 13 - 65 3.3e-14 SecE/Sec61-gamma subunits of protein translocation complex
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 72
AclWI GGATC 3 cut(s) 20, 33, 208
AcsI RAATTY 1 cut(s) 95
AcyI GRCGYC 1 cut(s) 6
AfaI GTAC 1 cut(s) 118
AfeI AGCGCT 1 cut(s) 55
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
AlwI GGATC 3 cut(s) 20, 33, 208
Aor51HI AGCGCT 1 cut(s) 55
ApoI RAATTY 1 cut(s) 95
AspLEI GCGC 1 cut(s) 56
BamHI GGATCC 1 cut(s) 25
BanI GGYRCC 1 cut(s) 72
BccI CCATC 3 cut(s) 131, 133, 188
BfoI RGCGCY 1 cut(s) 57
BmiI GGNNCC 2 cut(s) 27, 74
Bpu10I CCTNAGC 1 cut(s) 45
BsaHI GRCGYC 1 cut(s) 6
BseMII CTCAG 2 cut(s) 30, 46
Bsh1285I CGRYCG 1 cut(s) 88
BshNI GGYRCC 1 cut(s) 72
BsiEI CGRYCG 1 cut(s) 88
Bsp143I GATC 4 cut(s) 25, 85, 168, 200
BspCNI CTCAG 2 cut(s) 29, 45
BspLI GGNNCC 2 cut(s) 27, 74
BspPI GGATC 3 cut(s) 20, 33, 208
BspT107I GGYRCC 1 cut(s) 72
BssMI GATC 4 cut(s) 25, 85, 168, 200
BssNI GRCGYC 1 cut(s) 6
BstACI GRCGYC 1 cut(s) 6
BstDEI CTNAG 3 cut(s) 16, 32, 45
BstH2I RGCGCY 1 cut(s) 57
BstHHI GCGC 1 cut(s) 56
BstKTI GATC 4 cut(s) 28, 88, 171, 203
BstMBI GATC 4 cut(s) 25, 85, 168, 200
BstMCI CGRYCG 1 cut(s) 88
BstX2I RGATCY 2 cut(s) 25, 200
BstYI RGATCY 2 cut(s) 25, 200
CfoI GCGC 1 cut(s) 56
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 117
CviJI RGCY 4 cut(s) 61, 82, 122, 166
CviKI_1 RGCY 4 cut(s) 61, 82, 122, 166
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 3 cut(s) 16, 32, 45
DpnI GATC 4 cut(s) 27, 87, 170, 202
DpnII GATC 4 cut(s) 25, 85, 168, 200
Eco47III AGCGCT 1 cut(s) 55
EcoRI GAATTC 1 cut(s) 95
FalI AAGNNNNNCTT 2 cut(s) 155, 187
GlaI GCGC 1 cut(s) 55
HaeII RGCGCY 1 cut(s) 57
HgaI GACGC 1 cut(s) 14
HhaI GCGC 1 cut(s) 56
Hin1I GRCGYC 1 cut(s) 6
Hin6I GCGC 1 cut(s) 54
HinP1I GCGC 1 cut(s) 54
HinfI GANTC 2 cut(s) 14, 144
Hpy188I TCNGA 2 cut(s) 35, 200
Hpy188III TCNNGA 2 cut(s) 67, 160
Hpy99I CGWCG 1 cut(s) 200
HpyF3I CTNAG 3 cut(s) 16, 32, 45
Hsp92I GRCGYC 1 cut(s) 6
HspAI GCGC 1 cut(s) 54
Kzo9I GATC 4 cut(s) 25, 85, 168, 200
MalI GATC 4 cut(s) 27, 87, 170, 202
MboI GATC 4 cut(s) 25, 85, 168, 200
MboII GAAGA 1 cut(s) 163
MflI RGATCY 2 cut(s) 25, 200
MluCI AATT 1 cut(s) 95
MlyI GAGTC 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 2 cut(s) 39, 63
NdeII GATC 4 cut(s) 25, 85, 168, 200
NlaIV GGNNCC 2 cut(s) 27, 74
NmeAIII GCCGAG 1 cut(s) 37
PfeI GAWTC 1 cut(s) 144
Ple19I CGATCG 1 cut(s) 88
PleI GAGTC 1 cut(s) 8
PpsI GAGTC 1 cut(s) 8
PspN4I GGNNCC 2 cut(s) 27, 74
PsuI RGATCY 2 cut(s) 25, 200
PvuI CGATCG 1 cut(s) 88
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
Sau3AI GATC 4 cut(s) 25, 85, 168, 200
SchI GAGTC 1 cut(s) 8
SetI ASST 3 cut(s) 74, 108, 168
SgeI CNNG 7 cut(s) 69, 74, 79, 91, 95, 139, 172
Sse9I AATT 1 cut(s) 95
TasI AATT 1 cut(s) 95
TfiI GAWTC 1 cut(s) 144
TspDTI ATGAA 1 cut(s) 163
XapI RAATTY 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.