AT5G20970

Belongs to the small heat shock protein (HSP20) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0010040
Physical Location & Seq
Forward (+)
7122800 .. 7124001
1202 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G20970.1

Sequence Viewer

Length: 750 bp
ATGGCTAACTTTGGAATCGAACGTGTTTACCAAGAATTTGAGCCTGCAACTAGATGGACCTCTGAACCAGACGCCGAGGTTCTTGTCGCTGATCTTCCAGGATTCAAGAAAGAACAACTTAAAGTGTCGGTAACTGCAACAAGGAAGCTAAGACTAACAGGAGAACGCCCAACTGGTGGAAACAAATGGATTCGCTTCCACCAGGAAATTCCAGTTCCATTGACCGTTGACATCGACTCAGTTTCAGCCATGTTCAAGGATAACAAACTCTACATCCGGCATCCCAAACTCAAAACAGAAATCCCTCAAACCAAGCCACCAACACCGGTGATCATGAAACCCCATGATCAGCATGAGAGAAAACAAGGCCAGGGTCCAAAGGCAATGGTTGAGAAGCCAAGCGGTGGTAAAACCGATCAGCTGAAACATGATGCACAGCAGCTAAAACATGATGCACAGCAGCTGAAACATGATGCACAGCAAAAAGCAAGGGAGGTAGTACAGAGTGGAAAGAATAAATTAACTGGTGAGCCTAAAGGACCTTTGAGTTCCAAGGATGACGAGAAAGACAAAGTTGGAGCGAAATGGTTTGAGAAGTACAAAGAGGCAACTGGAAATGTGGTAAAGGAAGCAAAGAACAAAAGACAGTTACTTTGCAATTTGGCTGCTTCGGTTTCATTGGTTCTGCTAATCTTACTGTATGCTAGAAATGCAGTACGTTCATCCCTTGTGTGGAAATCCGAGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
HSP20

Protein Analysis

249

Amino Acids

28.13

Weight (kDa)

9.59

Isoelectric Point (pI)

36.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP20 PF00011 20 - 102 1.1e-06 Hsp20/alpha crystallin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 176, 404
AciI CCGC 1 cut(s) 402
AcsI RAATTY 2 cut(s) 35, 207
AcyI GRCGYC 1 cut(s) 72
AfaI GTAC 3 cut(s) 501, 599, 717
AfiI CCNNNNNNNGG 3 cut(s) 176, 404, 732
AflIII ACRYGT 1 cut(s) 22
AgeI ACCGGT 1 cut(s) 325
AgsI TTSAA 2 cut(s) 106, 256
AjnI CCWGG 3 cut(s) 97, 201, 369
AluBI AGCT 4 cut(s) 148, 421, 442, 463
AluI AGCT 4 cut(s) 148, 421, 442, 463
AlwNI CAGNNNCTG 1 cut(s) 463
AoxI GGCC 1 cut(s) 367
ApeKI GCWGC 3 cut(s) 439, 460, 665
ApoI RAATTY 2 cut(s) 35, 207
ArsI GACNNNNNNTTYG 2 cut(s) 636, 668
AsiGI ACCGGT 1 cut(s) 325
AspS9I GGNCC 3 cut(s) 57, 374, 539
AsuHPI GGTGA 2 cut(s) 340, 539
AvaII GGWCC 3 cut(s) 57, 374, 539
BbvI GCAGC 3 cut(s) 451, 472, 652
BccI CCATC 1 cut(s) 48
BciT130I CCWGG 3 cut(s) 99, 203, 371
BclI TGATCA 2 cut(s) 330, 346
BfaI CTAG 2 cut(s) 51, 705
BisI GCNGC 3 cut(s) 440, 461, 666
BlsI GCNGC 3 cut(s) 441, 462, 667
Bme1390I CCNGG 3 cut(s) 99, 203, 371
Bme18I GGWCC 3 cut(s) 57, 374, 539
BmgT120I GGNCC 3 cut(s) 57, 374, 539
BmiI GGNNCC 1 cut(s) 375
BmrFI CCNGG 3 cut(s) 99, 203, 371
BmsI GCATC 4 cut(s) 289, 421, 442, 463
BsaHI GRCGYC 1 cut(s) 72
BsaJI CCNNGG 4 cut(s) 75, 370, 552, 741
BsaWI WCCGGW 1 cut(s) 325
Bsc4I CCNNNNNNNGG 3 cut(s) 176, 404, 732
Bse118I RCCGGY 1 cut(s) 325
Bse1I ACTGG 4 cut(s) 178, 212, 529, 616
Bse3DI GCAATG 1 cut(s) 390
BseBI CCWGG 3 cut(s) 99, 203, 371
BseDI CCNNGG 4 cut(s) 75, 370, 552, 741
BseGI GGATG 4 cut(s) 273, 280, 562, 722
BseLI CCNNNNNNNGG 3 cut(s) 176, 404, 732
BseMI GCAATG 1 cut(s) 390
BseMII CTCAG 1 cut(s) 252
BseNI ACTGG 4 cut(s) 178, 212, 529, 616
BseXI GCAGC 3 cut(s) 451, 472, 652
BshFI GGCC 1 cut(s) 369
BshTI ACCGGT 1 cut(s) 325
BsiSI CCGG 2 cut(s) 277, 326
BslI CCNNNNNNNGG 3 cut(s) 176, 404, 732
BsnI GGCC 1 cut(s) 369
Bsp143I GATC 4 cut(s) 91, 330, 346, 415
BspACI CCGC 1 cut(s) 402
BspANI GGCC 1 cut(s) 369
BspCNI CTCAG 1 cut(s) 251
BspHI TCATGA 1 cut(s) 333
BspLI GGNNCC 1 cut(s) 375
BsrDI GCAATG 1 cut(s) 390
BsrFI RCCGGY 1 cut(s) 325
BsrI ACTGG 4 cut(s) 178, 212, 529, 616
BssAI RCCGGY 1 cut(s) 325
BssECI CCNNGG 4 cut(s) 75, 370, 552, 741
BssMI GATC 4 cut(s) 91, 330, 346, 415
BssNI GRCGYC 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 552
Bst2UI CCWGG 3 cut(s) 99, 203, 371
Bst4CI ACNGT 3 cut(s) 226, 648, 699
BstACI GRCGYC 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 2 cut(s) 149, 238
BstF5I GGATG 4 cut(s) 273, 280, 562, 722
BstKTI GATC 4 cut(s) 94, 333, 349, 418
BstMBI GATC 4 cut(s) 91, 330, 346, 415
BstMWI GCNNNNNNNGC 1 cut(s) 710
BstNI CCWGG 3 cut(s) 99, 203, 371
BstSCI CCNGG 3 cut(s) 97, 201, 369
BstV1I GCAGC 3 cut(s) 451, 472, 652
BsuRI GGCC 1 cut(s) 369
BtsCI GGATG 4 cut(s) 273, 280, 562, 722
Cac8I GCNNGC 1 cut(s) 45
CaiI CAGNNNCTG 1 cut(s) 463
CciI TCATGA 1 cut(s) 333
Cfr10I RCCGGY 1 cut(s) 325
Cfr13I GGNCC 3 cut(s) 57, 374, 539
CseI GACGC 1 cut(s) 80
Csp6I GTAC 3 cut(s) 500, 598, 716
CspAI ACCGGT 1 cut(s) 325
CviAII CATG 7 cut(s) 250, 334, 344, 353, 428, 449, 470
CviQI GTAC 3 cut(s) 500, 598, 716
DdeI CTNAG 2 cut(s) 149, 238
DpnI GATC 4 cut(s) 93, 332, 348, 417
DpnII GATC 4 cut(s) 91, 330, 346, 415
Eco130I CCWWGG 1 cut(s) 552
Eco47I GGWCC 3 cut(s) 57, 374, 539
EcoO109I RGGNCCY 1 cut(s) 539
EcoRII CCWGG 3 cut(s) 97, 201, 369
EcoT14I CCWWGG 1 cut(s) 552
ErhI CCWWGG 1 cut(s) 552
FaeI CATG 7 cut(s) 253, 337, 347, 356, 431, 452, 473
FaiI YATR 8 cut(s) 251, 335, 345, 354, 429, 450, 471, 702
FalI AAGNNNNNCTT 2 cut(s) 102, 134
FatI CATG 7 cut(s) 249, 333, 343, 352, 427, 448, 469
FbaI TGATCA 2 cut(s) 330, 346
Fnu4HI GCNGC 3 cut(s) 440, 461, 666
FokI GGATG 4 cut(s) 260, 267, 569, 709
Fsp4HI GCNGC 3 cut(s) 440, 461, 666
FspBI CTAG 2 cut(s) 51, 705
GluI GCNGC 3 cut(s) 440, 461, 666
HaeIII GGCC 1 cut(s) 369
HapII CCGG 2 cut(s) 277, 326
HgaI GACGC 1 cut(s) 80
Hin1I GRCGYC 1 cut(s) 72
Hin1II CATG 7 cut(s) 253, 337, 347, 356, 431, 452, 473
HincII GTYRAC 1 cut(s) 229
HindII GTYRAC 1 cut(s) 229
HinfI GANTC 4 cut(s) 15, 102, 190, 236
HpaII CCGG 2 cut(s) 277, 326
HphI GGTGA 2 cut(s) 340, 539
Hpy166II GTNNAC 2 cut(s) 28, 229
Hpy188I TCNGA 2 cut(s) 64, 742
Hpy188III TCNNGA 2 cut(s) 106, 334
Hpy8I GTNNAC 2 cut(s) 28, 229
HpyCH4III ACNGT 3 cut(s) 226, 648, 699
HpyCH4IV ACGT 2 cut(s) 22, 718
HpyCH4V TGCA 7 cut(s) 47, 137, 434, 455, 476, 657, 713
HpyF10VI GCNNNNNNNGC 1 cut(s) 710
HpyF3I CTNAG 2 cut(s) 149, 238
HpySE526I ACGT 2 cut(s) 22, 718
Hsp92I GRCGYC 1 cut(s) 72
Hsp92II CATG 7 cut(s) 253, 337, 347, 356, 431, 452, 473
Ksp22I TGATCA 2 cut(s) 330, 346
Kzo9I GATC 4 cut(s) 91, 330, 346, 415
LmnI GCTCC 1 cut(s) 578
Lsp1109I GCAGC 3 cut(s) 451, 472, 652
LweI GCATC 4 cut(s) 289, 421, 442, 463
MaeI CTAG 2 cut(s) 51, 705
MaeII ACGT 2 cut(s) 22, 718
MaeIII GTNAC 2 cut(s) 130, 648
MalI GATC 4 cut(s) 93, 332, 348, 417
MboI GATC 4 cut(s) 91, 330, 346, 415
MboII GAAGA 1 cut(s) 86
MluCI AATT 4 cut(s) 35, 207, 518, 658
MlyI GAGTC 1 cut(s) 230
MmeI TCCRAC 1 cut(s) 556
MnlI CCTC 6 cut(s) 70, 70, 315, 487, 598, 736
MseI TTAA 2 cut(s) 120, 521
MspA1I CMGCKG 2 cut(s) 421, 463
MspI CCGG 2 cut(s) 277, 326
MspR9I CCNGG 3 cut(s) 99, 203, 371
MvaI CCWGG 3 cut(s) 99, 203, 371
MwoI GCNNNNNNNGC 1 cut(s) 710
NdeII GATC 4 cut(s) 91, 330, 346, 415
NlaIII CATG 7 cut(s) 253, 337, 347, 356, 431, 452, 473
NlaIV GGNNCC 1 cut(s) 375
NmeAIII GCCGAG 1 cut(s) 100
PagI TCATGA 1 cut(s) 333
PfeI GAWTC 3 cut(s) 15, 102, 190
PflMI CCANNNNNTGG 2 cut(s) 176, 404
PfoI TCCNGGA 1 cut(s) 97
PinAI ACCGGT 1 cut(s) 325
PkrI GCNGC 3 cut(s) 441, 462, 667
PleI GAGTC 1 cut(s) 230
PpsI GAGTC 1 cut(s) 230
PpuMI RGGWCCY 1 cut(s) 539
Psp5II RGGWCCY 1 cut(s) 539
Psp6I CCWGG 3 cut(s) 97, 201, 369
PspGI CCWGG 3 cut(s) 97, 201, 369
PspN4I GGNNCC 1 cut(s) 375
PspPI GGNCC 3 cut(s) 57, 374, 539
PspPPI RGGWCCY 1 cut(s) 539
PstNI CAGNNNCTG 1 cut(s) 463
PvuII CAGCTG 2 cut(s) 421, 463
RsaI GTAC 3 cut(s) 501, 599, 717
RsaNI GTAC 3 cut(s) 500, 598, 716
SaqAI TTAA 2 cut(s) 120, 521
SatI GCNGC 3 cut(s) 440, 461, 666
Sau3AI GATC 4 cut(s) 91, 330, 346, 415
Sau96I GGNCC 3 cut(s) 57, 374, 539
SchI GAGTC 1 cut(s) 230
ScrFI CCNGG 3 cut(s) 99, 203, 371
SfaNI GCATC 4 cut(s) 289, 421, 442, 463
SgrAI CRCCGGYG 1 cut(s) 325
SinI GGWCC 3 cut(s) 57, 374, 539
Sse9I AATT 4 cut(s) 35, 207, 518, 658
SsiI CCGC 1 cut(s) 402
SspMI CTAG 2 cut(s) 51, 705
StyD4I CCNGG 3 cut(s) 97, 201, 369
StyI CCWWGG 1 cut(s) 552
TaaI ACNGT 3 cut(s) 226, 648, 699
TaiI ACGT 2 cut(s) 25, 721
TaqI TCGA 2 cut(s) 18, 234
TasI AATT 4 cut(s) 35, 207, 518, 658
TatI WGTACW 2 cut(s) 499, 597
TfiI GAWTC 3 cut(s) 15, 102, 190
Tru1I TTAA 2 cut(s) 120, 521
Tru9I TTAA 2 cut(s) 120, 521
TseI GCWGC 3 cut(s) 439, 460, 665
TspDTI ATGAA 3 cut(s) 350, 666, 711
Van91I CCANNNNNTGG 2 cut(s) 176, 404
VpaK11BI GGWCC 3 cut(s) 57, 374, 539
XapI RAATTY 2 cut(s) 35, 207
XspI CTAG 2 cut(s) 51, 705
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.