MD03G1162700.v1.1

Belongs to the small heat shock protein (HSP20) family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Forward (+)
19701911 .. 19702433
523 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1162700.v1.1.491

Sequence Viewer

Length: 225 bp
ATGGAGGGAAAGCCAAATTCTGCAACTATTAATCGTGTTTACGAAGACATTAAACCATCAGAAGAATGGGCAAGGGAGGAAGCTTGTGACACTCTCCTCGTCTATCTGCAAGGATTTAGAAAGGAGAATCTGAGGATTCAAGTGATGTTAGCTGATCAAAACTTAAGGGTGCTTGGTGAACGGCCACTTGGTCATGACAACAAATGGCAGCGTTTCCGCATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.79

Weight (kDa)

6.57

Isoelectric Point (pI)

33.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 217
AcoI YGGCCR 1 cut(s) 182
AcsI RAATTY 1 cut(s) 16
AflII CTTAAG 1 cut(s) 163
AgsI TTSAA 1 cut(s) 140
AjuI GAANNNNNNNTTGG 2 cut(s) 171, 203
AluBI AGCT 2 cut(s) 83, 152
AluI AGCT 2 cut(s) 83, 152
AoxI GGCC 1 cut(s) 182
ApeKI GCWGC 1 cut(s) 208
ApoI RAATTY 1 cut(s) 16
AseI ATTAAT 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 188
BbsI GAAGAC 1 cut(s) 51
BbvI GCAGC 1 cut(s) 220
BccI CCATC 1 cut(s) 64
BceAI ACGGC 1 cut(s) 197
BclI TGATCA 1 cut(s) 154
BfrI CTTAAG 1 cut(s) 163
BisI GCNGC 1 cut(s) 209
BlsI GCNGC 1 cut(s) 210
BpiI GAAGAC 1 cut(s) 51
BseMII CTCAG 1 cut(s) 122
BseRI GAGGAG 1 cut(s) 86
BseXI GCAGC 1 cut(s) 220
BshFI GGCC 1 cut(s) 184
BsnI GGCC 1 cut(s) 184
Bsp143I GATC 1 cut(s) 154
BspACI CCGC 1 cut(s) 217
BspANI GGCC 1 cut(s) 184
BspCNI CTCAG 1 cut(s) 123
BspHI TCATGA 1 cut(s) 193
BspTI CTTAAG 1 cut(s) 163
BssMI GATC 1 cut(s) 154
BstAFI CTTAAG 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstV1I GCAGC 1 cut(s) 220
BstV2I GAAGAC 1 cut(s) 51
BsuRI GGCC 1 cut(s) 184
CciI TCATGA 1 cut(s) 193
CviAII CATG 1 cut(s) 194
CviJI RGCY 4 cut(s) 13, 83, 152, 184
CviKI_1 RGCY 4 cut(s) 13, 83, 152, 184
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
EaeI YGGCCR 1 cut(s) 182
FaeI CATG 1 cut(s) 197
FaiI YATR 3 cut(s) 195, 221, 223
FatI CATG 1 cut(s) 193
FbaI TGATCA 1 cut(s) 154
Fnu4HI GCNGC 1 cut(s) 209
Fsp4HI GCNGC 1 cut(s) 209
GluI GCNGC 1 cut(s) 209
HaeIII GGCC 1 cut(s) 184
Hin1II CATG 1 cut(s) 197
HindIII AAGCTT 1 cut(s) 81
HinfI GANTC 2 cut(s) 127, 136
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 2 cut(s) 40, 179
Hpy188I TCNGA 2 cut(s) 61, 132
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 2 cut(s) 40, 179
HpyCH4V TGCA 2 cut(s) 23, 109
HpyF3I CTNAG 1 cut(s) 131
Hsp92II CATG 1 cut(s) 197
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 1 cut(s) 154
Lsp1109I GCAGC 1 cut(s) 220
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 2 cut(s) 56, 74
MluCI AATT 1 cut(s) 16
MnlI CCTC 3 cut(s) 70, 107, 126
MseI TTAA 3 cut(s) 30, 51, 164
MspCI CTTAAG 1 cut(s) 163
NdeII GATC 1 cut(s) 154
NlaIII CATG 1 cut(s) 197
NmuCI GTSAC 1 cut(s) 86
PagI TCATGA 1 cut(s) 193
PfeI GAWTC 2 cut(s) 127, 136
PkrI GCNGC 1 cut(s) 210
PshBI ATTAAT 1 cut(s) 30
SaqAI TTAA 3 cut(s) 30, 51, 164
SatI GCNGC 1 cut(s) 209
Sau3AI GATC 1 cut(s) 154
SetI ASST 2 cut(s) 85, 154
SgeI CNNG 9 cut(s) 47, 84, 96, 110, 122, 152, 185, 200, 206
SmlI CTYRAG 1 cut(s) 163
SmoI CTYRAG 1 cut(s) 163
Sse9I AATT 1 cut(s) 16
SsiI CCGC 1 cut(s) 217
TasI AATT 1 cut(s) 16
TfiI GAWTC 2 cut(s) 127, 136
Tru1I TTAA 3 cut(s) 30, 51, 164
Tru9I TTAA 3 cut(s) 30, 51, 164
TseFI GTSAC 1 cut(s) 86
TseI GCWGC 1 cut(s) 208
Tsp45I GTSAC 1 cut(s) 86
Vha464I CTTAAG 1 cut(s) 163
VspI ATTAAT 1 cut(s) 30
XapI RAATTY 1 cut(s) 16
XcmI CCANNNNNNNNNTGG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.