FvH4_1g09717

1-deoxy-D-xylulose 5-phosphate reductoisomerase

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
5289113 .. 5289562
450 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g09717.t1

Sequence Viewer

Length: 246 bp
ATGGGAAAGAAGATAACTGTTGATTCAGCTACTCTTTTCAATAAGGGGCTAGAAGTCATCGAAGCCCATTACTTGTACGGAGCTGATTATGATGATATCGAGATTGTAATTCATCCACAATCCATCATACATTCGATGATTGAAACACAGGATTCATCTGTTCTAGCACAGTTGGGGTGGCCTGATATGCGCTTGCCAATCCTCTACACCATGCATGGCCAGAGAGAATCTATTGCTCCGAAGTGA

Protein Analysis

82

Amino Acids

9.14

Weight (kDa)

5.09

Isoelectric Point (pI)

62.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DXP_redisom_C PF08436 1 - 26 7.9e-11 1-deoxy-D-xylulose 5-phosphate reductoisomerase C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 217
AfaI GTAC 1 cut(s) 77
AgsI TTSAA 2 cut(s) 40, 143
AluBI AGCT 2 cut(s) 29, 83
AluI AGCT 2 cut(s) 29, 83
AoxI GGCC 2 cut(s) 179, 217
AspLEI GCGC 1 cut(s) 192
BalI TGGCCA 1 cut(s) 219
BccI CCATC 1 cut(s) 131
BfaI CTAG 2 cut(s) 50, 164
BseGI GGATG 1 cut(s) 112
BshFI GGCC 2 cut(s) 181, 219
BsnI GGCC 2 cut(s) 181, 219
BspANI GGCC 2 cut(s) 181, 219
Bst4CI ACNGT 2 cut(s) 19, 171
BstC8I GCNNGC 1 cut(s) 194
BstF5I GGATG 1 cut(s) 112
BstHHI GCGC 1 cut(s) 192
BstMWI GCNNNNNNNGC 1 cut(s) 187
BsuRI GGCC 2 cut(s) 181, 219
BtsCI GGATG 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 194
CfoI GCGC 1 cut(s) 192
Csp6I GTAC 1 cut(s) 76
CviAII CATG 2 cut(s) 211, 215
CviJI RGCY 6 cut(s) 29, 49, 65, 83, 181, 219
CviKI_1 RGCY 6 cut(s) 29, 49, 65, 83, 181, 219
CviQI GTAC 1 cut(s) 76
EaeI YGGCCR 1 cut(s) 217
Eco32I GATATC 1 cut(s) 97
EcoRV GATATC 1 cut(s) 97
EcoT22I ATGCAT 1 cut(s) 216
FaeI CATG 2 cut(s) 214, 218
FaiI YATR 5 cut(s) 90, 128, 188, 212, 216
FatI CATG 2 cut(s) 210, 214
FokI GGATG 1 cut(s) 99
FspBI CTAG 2 cut(s) 50, 164
GlaI GCGC 1 cut(s) 191
HaeIII GGCC 2 cut(s) 181, 219
HhaI GCGC 1 cut(s) 192
Hin1II CATG 2 cut(s) 214, 218
Hin6I GCGC 1 cut(s) 190
HinP1I GCGC 1 cut(s) 190
HinfI GANTC 3 cut(s) 23, 152, 227
Hpy188I TCNGA 1 cut(s) 240
Hpy188III TCNNGA 1 cut(s) 100
HpyCH4III ACNGT 2 cut(s) 19, 171
HpyCH4V TGCA 1 cut(s) 214
HpyF10VI GCNNNNNNNGC 1 cut(s) 187
Hsp92II CATG 2 cut(s) 214, 218
HspAI GCGC 1 cut(s) 190
LmnI GCTCC 2 cut(s) 80, 241
LpnPI CCDG 3 cut(s) 134, 195, 233
MaeI CTAG 2 cut(s) 50, 164
MboII GAAGA 1 cut(s) 22
MlsI TGGCCA 1 cut(s) 219
MluCI AATT 1 cut(s) 108
MluNI TGGCCA 1 cut(s) 219
MnlI CCTC 1 cut(s) 212
Mox20I TGGCCA 1 cut(s) 219
Mph1103I ATGCAT 1 cut(s) 216
MscI TGGCCA 1 cut(s) 219
Msp20I TGGCCA 1 cut(s) 219
MwoI GCNNNNNNNGC 1 cut(s) 187
NlaIII CATG 2 cut(s) 214, 218
NsiI ATGCAT 1 cut(s) 216
PfeI GAWTC 3 cut(s) 23, 152, 227
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
SetI ASST 2 cut(s) 31, 85
Sse9I AATT 1 cut(s) 108
SspMI CTAG 2 cut(s) 50, 164
TaaI ACNGT 2 cut(s) 19, 171
TaqI TCGA 3 cut(s) 60, 99, 134
TasI AATT 1 cut(s) 108
TfiI GAWTC 3 cut(s) 23, 152, 227
TspDTI ATGAA 2 cut(s) 101, 144
TspGWI ACGGA 1 cut(s) 93
XspI CTAG 2 cut(s) 50, 164
Zsp2I ATGCAT 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.