FvH4_2g08920

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Reverse (-)
7793127 .. 7795227
2101 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g08920.t1

Sequence Viewer

Length: 327 bp
ATGGAATCACAGAAAAGCCAAGTTGAAAATCAGCCTATTGAACCAACCACTACTGCACTTGCTGCTGGAACAACCCCTACTCCCCCTGCTGCTGCTGCAACCCCCACATCATGCCGAAAAAAGAAGAATGAACAAGCTACTTTCTTGGAAGATGTGAAGGATCACATTGATGAGTTTATCCACGCTTCTATGGATGAACATGTGTCTTGCTTCAAGAAGACCATTGACAAGATGTTTAAAATGTCAAAGGTTGTTGCTGAGAAGAATGCTGCTGATGCCAAGGGAGTTGAGAGTTCTTTGCCGCTTCAAACAACTGTAGCAGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

11.69

Weight (kDa)

5.58

Isoelectric Point (pI)

51.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 302
AclWI GGATC 1 cut(s) 168
AflIII ACRYGT 1 cut(s) 199
AgsI TTSAA 4 cut(s) 26, 41, 214, 308
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AlwI GGATC 1 cut(s) 168
ApeKI GCWGC 5 cut(s) 62, 89, 92, 95, 269
BbsI GAAGAC 1 cut(s) 224
BbvI GCAGC 5 cut(s) 49, 76, 79, 82, 256
BfmI CTRYAG 1 cut(s) 315
BisI GCNGC 6 cut(s) 63, 90, 93, 96, 270, 302
BlsI GCNGC 6 cut(s) 64, 91, 94, 97, 271, 303
BmsI GCATC 1 cut(s) 265
BpiI GAAGAC 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 279
BsaXI ACNNNNNCTCC 2 cut(s) 64, 94
BseDI CCNNGG 1 cut(s) 279
BseGI GGATG 1 cut(s) 199
BseMII CTCAG 1 cut(s) 249
BseXI GCAGC 5 cut(s) 49, 76, 79, 82, 256
BsgI GTGCAG 1 cut(s) 39
BsmI GAATGC 1 cut(s) 271
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 1 cut(s) 302
BspCNI CTCAG 1 cut(s) 250
BspPI GGATC 1 cut(s) 168
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 279
Bst4CI ACNGT 1 cut(s) 316
BstAPI GCANNNNNTGC 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 258
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 3 cut(s) 62, 95, 275
BstNSI RCATGY 1 cut(s) 203
BstSFI CTRYAG 1 cut(s) 315
BstV1I GCAGC 5 cut(s) 49, 76, 79, 82, 256
BstV2I GAAGAC 1 cut(s) 224
BtsCI GGATG 1 cut(s) 199
CviAII CATG 2 cut(s) 111, 200
CviJI RGCY 3 cut(s) 18, 34, 137
CviKI_1 RGCY 3 cut(s) 18, 34, 137
DdeI CTNAG 1 cut(s) 258
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
DraI TTTAAA 1 cut(s) 238
Eco130I CCWWGG 1 cut(s) 279
EcoT14I CCWWGG 1 cut(s) 279
ErhI CCWWGG 1 cut(s) 279
FaeI CATG 2 cut(s) 114, 203
FaiI YATR 3 cut(s) 112, 191, 201
FatI CATG 2 cut(s) 110, 199
Fnu4HI GCNGC 6 cut(s) 63, 90, 93, 96, 270, 302
FokI GGATG 1 cut(s) 206
Fsp4HI GCNGC 6 cut(s) 63, 90, 93, 96, 270, 302
GluI GCNGC 6 cut(s) 63, 90, 93, 96, 270, 302
Hin1II CATG 2 cut(s) 114, 203
HinfI GANTC 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 151
HpyCH4III ACNGT 1 cut(s) 316
HpyCH4V TGCA 2 cut(s) 56, 98
HpyF10VI GCNNNNNNNGC 3 cut(s) 62, 95, 275
HpyF3I CTNAG 1 cut(s) 258
Hsp92II CATG 2 cut(s) 114, 203
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 2 cut(s) 51, 99
Lsp1109I GCAGC 5 cut(s) 49, 76, 79, 82, 256
LweI GCATC 1 cut(s) 265
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 4 cut(s) 136, 161, 229, 274
MseI TTAA 1 cut(s) 237
MslI CAYNNNNRTG 1 cut(s) 168
Mva1269I GAATGC 1 cut(s) 271
MwoI GCNNNNNNNGC 3 cut(s) 62, 95, 275
NdeII GATC 1 cut(s) 160
NlaIII CATG 2 cut(s) 114, 203
NspI RCATGY 1 cut(s) 203
PciI ACATGT 1 cut(s) 199
PctI GAATGC 1 cut(s) 271
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 6 cut(s) 64, 91, 94, 97, 271, 303
PscI ACATGT 1 cut(s) 199
PsrI GAACNNNNNNTAC 2 cut(s) 61, 93
RseI CAYNNNNRTG 1 cut(s) 168
SaqAI TTAA 1 cut(s) 237
SatI GCNGC 6 cut(s) 63, 90, 93, 96, 270, 302
Sau3AI GATC 1 cut(s) 160
SetI ASST 2 cut(s) 139, 252
SfaNI GCATC 1 cut(s) 265
SfcI CTRYAG 1 cut(s) 315
SmiMI CAYNNNNRTG 1 cut(s) 168
SsiI CCGC 1 cut(s) 302
StyI CCWWGG 1 cut(s) 279
TaaI ACNGT 1 cut(s) 316
TauI GCSGC 1 cut(s) 304
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TseI GCWGC 5 cut(s) 62, 89, 92, 95, 269
TspDTI ATGAA 2 cut(s) 144, 210
XceI RCATGY 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.