Rh4BG347000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
50931352 .. 50931648
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG347000.1

Sequence Viewer

Length: 297 bp
ATGGAATCGCAGAAAAGTCAACTTGAGAAACAGCCTGCTGCAACAACCCCTACTTCACCCGCTGCTGCAACTCCCACATCATGTCGAAAGAAGAAGAATGAACAAGCCAATTTTCTGGAAGATGTGAAGGATCACATTGATGAATTTATCAATGCATCTATGGATGAACACGCGTCTTGCTTCAAGAAGACCATCAACAAGATGTTTAAAATGTCAAAGATTGTTGCTGAGAAGAATGCTGCTGATACCAAGGAAGTCGAAAGTTCGCTGCCCCTTCAAACAACAGTAGCAGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.83

Weight (kDa)

6.11

Isoelectric Point (pI)

55.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 173
AciI CCGC 1 cut(s) 60
AclWI GGATC 1 cut(s) 138
AcsI RAATTY 1 cut(s) 143
AflIII ACRYGT 1 cut(s) 171
AgsI TTSAA 2 cut(s) 184, 278
AlwI GGATC 1 cut(s) 138
ApeKI GCWGC 5 cut(s) 38, 62, 65, 239, 268
ApoI RAATTY 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 48
BbsI GAAGAC 1 cut(s) 194
BbvI GCAGC 5 cut(s) 25, 49, 52, 226, 255
BccI CCATC 1 cut(s) 200
BisI GCNGC 5 cut(s) 39, 63, 66, 240, 269
BlsI GCNGC 5 cut(s) 40, 64, 67, 241, 270
BmsI GCATC 1 cut(s) 164
BpiI GAAGAC 1 cut(s) 194
BpuEI CTTGAG 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 249
BseDI CCNNGG 1 cut(s) 249
BseGI GGATG 1 cut(s) 169
BseMII CTCAG 1 cut(s) 219
BseXI GCAGC 5 cut(s) 25, 49, 52, 226, 255
Bsh1236I CGCG 1 cut(s) 173
BsmI GAATGC 1 cut(s) 241
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 1 cut(s) 60
BspCNI CTCAG 1 cut(s) 220
BspFNI CGCG 1 cut(s) 173
BspPI GGATC 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 249
BssMI GATC 1 cut(s) 130
BssT1I CCWWGG 1 cut(s) 249
Bst4CI ACNGT 1 cut(s) 286
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 228
BstF5I GGATG 1 cut(s) 169
BstFNI CGCG 1 cut(s) 173
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstUI CGCG 1 cut(s) 173
BstV1I GCAGC 5 cut(s) 25, 49, 52, 226, 255
BstV2I GAAGAC 1 cut(s) 194
BstXI CCANNNNNNTGG 1 cut(s) 115
BtsCI GGATG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 36
CseI GACGC 1 cut(s) 162
CviAII CATG 1 cut(s) 81
CviJI RGCY 2 cut(s) 34, 107
CviKI_1 RGCY 2 cut(s) 34, 107
DdeI CTNAG 1 cut(s) 228
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
DraI TTTAAA 1 cut(s) 208
Eco130I CCWWGG 1 cut(s) 249
EcoT14I CCWWGG 1 cut(s) 249
EcoT22I ATGCAT 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 249
FaeI CATG 1 cut(s) 84
FaiI YATR 2 cut(s) 82, 161
FatI CATG 1 cut(s) 80
FauI CCCGC 1 cut(s) 67
Fnu4HI GCNGC 5 cut(s) 39, 63, 66, 240, 269
FokI GGATG 1 cut(s) 176
Fsp4HI GCNGC 5 cut(s) 39, 63, 66, 240, 269
GluI GCNGC 5 cut(s) 39, 63, 66, 240, 269
HgaI GACGC 1 cut(s) 162
Hin1II CATG 1 cut(s) 84
HincII GTYRAC 1 cut(s) 20
HindII GTYRAC 1 cut(s) 20
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 48
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 2 cut(s) 116, 184
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 2 cut(s) 121, 284
HpyCH4III ACNGT 1 cut(s) 286
HpyCH4V TGCA 3 cut(s) 41, 68, 155
HpyF3I CTNAG 1 cut(s) 228
Hsp92II CATG 1 cut(s) 84
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 48, 101
Lsp1109I GCAGC 5 cut(s) 25, 49, 52, 226, 255
LweI GCATC 1 cut(s) 164
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 5 cut(s) 103, 106, 131, 199, 244
MluCI AATT 2 cut(s) 109, 143
MluI ACGCGT 1 cut(s) 171
Mph1103I ATGCAT 1 cut(s) 157
MseI TTAA 1 cut(s) 207
MslI CAYNNNNRTG 1 cut(s) 138
MspA1I CMGCKG 1 cut(s) 62
Mva1269I GAATGC 1 cut(s) 241
MvnI CGCG 1 cut(s) 173
NdeII GATC 1 cut(s) 130
NlaIII CATG 1 cut(s) 84
NsiI ATGCAT 1 cut(s) 157
PctI GAATGC 1 cut(s) 241
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 5 cut(s) 40, 64, 67, 241, 270
RseI CAYNNNNRTG 1 cut(s) 138
SaqAI TTAA 1 cut(s) 207
SatI GCNGC 5 cut(s) 39, 63, 66, 240, 269
Sau3AI GATC 1 cut(s) 130
SfaNI GCATC 1 cut(s) 164
SmiMI CAYNNNNRTG 1 cut(s) 138
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 2 cut(s) 109, 143
SsiI CCGC 1 cut(s) 60
StyI CCWWGG 1 cut(s) 249
TaaI ACNGT 1 cut(s) 286
TaqI TCGA 2 cut(s) 85, 258
TasI AATT 2 cut(s) 109, 143
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseI GCWGC 5 cut(s) 38, 62, 65, 239, 268
TspDTI ATGAA 3 cut(s) 114, 156, 180
XapI RAATTY 1 cut(s) 143
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.