FvH4_4g27401

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0004125
Physical Location & Seq
Forward (+)
28416417 .. 28416722
306 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g27401.t1

Sequence Viewer

Length: 306 bp
ATGGAATCACAGAATAGTCAACTTAAGAAACACCCTGCTGTAAGTCCTGTAACAATCCCTACTTCACCCGCTGCTGCAACTCCCACATCATGTCGAAAGAAGAAGAATGAACAAGCCACTTTCCTGGAAGATGTGAAGGATCACATTGATGAATTTATCAATGCATCTATGGATGAACATGCGTCTTGCTTCAAGAAGACAATCGACAAGATGTTCAGAATGTCGAAGATTGTTGCTGATAAGAATGCTGCTGATACCAAGGAAGTTGAAAGTTCGCTGCCCCTTCAAACAACAGTAGCAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.15

Weight (kDa)

6.28

Isoelectric Point (pI)

50.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 147
AcsI RAATTY 1 cut(s) 152
AflII CTTAAG 1 cut(s) 23
AgsI TTSAA 3 cut(s) 193, 269, 287
AjnI CCWGG 1 cut(s) 123
AlwI GGATC 1 cut(s) 147
ApeKI GCWGC 4 cut(s) 71, 74, 248, 277
ApoI RAATTY 1 cut(s) 152
AsuHPI GGTGA 1 cut(s) 57
BbsI GAAGAC 1 cut(s) 203
BbvI GCAGC 4 cut(s) 58, 61, 235, 264
BciT130I CCWGG 1 cut(s) 125
BfaI CTAG 1 cut(s) 304
BfrI CTTAAG 1 cut(s) 23
BisI GCNGC 4 cut(s) 72, 75, 249, 278
BlsI GCNGC 4 cut(s) 73, 76, 250, 279
Bme1390I CCNGG 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 125
BmsI GCATC 1 cut(s) 173
BpiI GAAGAC 1 cut(s) 203
BsaJI CCNNGG 1 cut(s) 258
BseBI CCWGG 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 258
BseGI GGATG 1 cut(s) 178
BseXI GCAGC 4 cut(s) 58, 61, 235, 264
BsmI GAATGC 1 cut(s) 250
Bsp143I GATC 1 cut(s) 139
BspACI CCGC 1 cut(s) 69
BspPI GGATC 1 cut(s) 147
BspTI CTTAAG 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 1 cut(s) 139
BssT1I CCWWGG 1 cut(s) 258
Bst2UI CCWGG 1 cut(s) 125
Bst4CI ACNGT 1 cut(s) 295
BstAFI CTTAAG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 178
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BstNI CCWGG 1 cut(s) 125
BstNSI RCATGY 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 123
BstV1I GCAGC 4 cut(s) 58, 61, 235, 264
BstV2I GAAGAC 1 cut(s) 203
BstXI CCANNNNNNTGG 1 cut(s) 124
BtsCI GGATG 1 cut(s) 178
CseI GACGC 1 cut(s) 171
CviAII CATG 2 cut(s) 90, 179
CviJI RGCY 1 cut(s) 116
CviKI_1 RGCY 1 cut(s) 116
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
Eco130I CCWWGG 1 cut(s) 258
EcoRII CCWGG 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 258
EcoT22I ATGCAT 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 258
FaeI CATG 2 cut(s) 93, 182
FaiI YATR 3 cut(s) 91, 170, 180
FatI CATG 2 cut(s) 89, 178
FauI CCCGC 1 cut(s) 76
Fnu4HI GCNGC 4 cut(s) 72, 75, 249, 278
FokI GGATG 1 cut(s) 185
Fsp4HI GCNGC 4 cut(s) 72, 75, 249, 278
FspBI CTAG 1 cut(s) 304
GluI GCNGC 4 cut(s) 72, 75, 249, 278
HgaI GACGC 1 cut(s) 171
Hin1II CATG 2 cut(s) 93, 182
HincII GTYRAC 1 cut(s) 20
HindII GTYRAC 1 cut(s) 20
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 218
Hpy188III TCNNGA 1 cut(s) 193
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 2 cut(s) 130, 293
HpyCH4III ACNGT 1 cut(s) 295
HpyCH4V TGCA 2 cut(s) 77, 164
Hsp92II CATG 2 cut(s) 93, 182
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 4 cut(s) 48, 60, 110, 137
Lsp1109I GCAGC 4 cut(s) 58, 61, 235, 264
LweI GCATC 1 cut(s) 173
MaeI CTAG 1 cut(s) 304
MaeIII GTNAC 1 cut(s) 49
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 5 cut(s) 112, 115, 140, 208, 238
MluCI AATT 1 cut(s) 152
Mph1103I ATGCAT 1 cut(s) 166
MseI TTAA 1 cut(s) 24
MslI CAYNNNNRTG 1 cut(s) 147
MspA1I CMGCKG 1 cut(s) 71
MspCI CTTAAG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 125
Mva1269I GAATGC 1 cut(s) 250
MvaI CCWGG 1 cut(s) 125
NdeII GATC 1 cut(s) 139
NlaIII CATG 2 cut(s) 93, 182
NsiI ATGCAT 1 cut(s) 166
NspI RCATGY 1 cut(s) 182
PctI GAATGC 1 cut(s) 250
PfeI GAWTC 1 cut(s) 5
PfoI TCCNGGA 1 cut(s) 123
PkrI GCNGC 4 cut(s) 73, 76, 250, 279
Psp6I CCWGG 1 cut(s) 123
PspGI CCWGG 1 cut(s) 123
RseI CAYNNNNRTG 1 cut(s) 147
SaqAI TTAA 1 cut(s) 24
SatI GCNGC 4 cut(s) 72, 75, 249, 278
Sau3AI GATC 1 cut(s) 139
ScrFI CCNGG 1 cut(s) 125
SfaNI GCATC 1 cut(s) 173
SmiMI CAYNNNNRTG 1 cut(s) 147
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 1 cut(s) 152
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 304
StyD4I CCNGG 1 cut(s) 123
StyI CCWWGG 1 cut(s) 258
TaaI ACNGT 1 cut(s) 295
TaqI TCGA 3 cut(s) 94, 204, 224
TasI AATT 1 cut(s) 152
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TseI GCWGC 4 cut(s) 71, 74, 248, 277
TspDTI ATGAA 3 cut(s) 123, 165, 189
Vha464I CTTAAG 1 cut(s) 23
XapI RAATTY 1 cut(s) 152
XceI RCATGY 1 cut(s) 182
XspI CTAG 1 cut(s) 304
Zsp2I ATGCAT 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.