FvH4_2g11352
MADS Family

MADS-box transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0011645
Physical Location & Seq
Reverse (-)
9873734 .. 9874652
919 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g11352.t1

Sequence Viewer

Length: 378 bp
ATGGGTGAAGAACTATCTGGATTGAGCGCCAAAGATCTACAGAACCTGGAAAGCAAACTGGACATGAGTTTGAAAGGTGTCCGGTTGAAAAAGGGAAATCTCATACATCAAGAGAACATAGAACTGTATAAGAAGCTAGACTTCATAGGTAAAGAGAATGCCGAACTCCAAAGAAAGGCCTATGGAACAAGGGATGTGAATGAAGAACACAGAGGCTCTGAACCCCCATTTGCCATTACTAATGGATTTCAGTTGCATGCACCCATCCATGTCCAGCTAAGCCAGCCACATAATCAAACTGATCAGCCACAGAACAATAATGCTCCAGCAAATGCAATCAAACTGGGGTACGTATCTCTTGAATACTCATTATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
K-box SRF-TF

Protein Analysis

126

Amino Acids

14.07

Weight (kDa)

6.19

Isoelectric Point (pI)

40.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
K-box PF01486 1 - 59 6.5e-13 K-box region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 350
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 3 cut(s) 73, 88, 362
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 2 cut(s) 136, 277
AluI AGCT 2 cut(s) 136, 277
AlwNI CAGNNNCTG 1 cut(s) 46
AoxI GGCC 1 cut(s) 177
AspLEI GCGC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 17
BccI CCATC 1 cut(s) 272
BciT130I CCWGG 1 cut(s) 47
BclI TGATCA 1 cut(s) 301
BfaI CTAG 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 38
BfoI RGCGCY 1 cut(s) 30
BglII AGATCT 1 cut(s) 34
BlpI GCTNAGC 1 cut(s) 278
Bme1390I CCNGG 1 cut(s) 47
BmrFI CCNGG 1 cut(s) 47
BmrI ACTGGG 1 cut(s) 353
BmuI ACTGGG 1 cut(s) 353
BpmI CTGGAG 1 cut(s) 309
Bpu1102I GCTNAGC 1 cut(s) 278
BsaAI YACGTR 1 cut(s) 352
BsaWI WCCGGW 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 175
Bse1I ACTGG 2 cut(s) 63, 348
BseBI CCWGG 1 cut(s) 47
BseGI GGATG 2 cut(s) 199, 264
BseLI CCNNNNNNNGG 1 cut(s) 175
BseNI ACTGG 2 cut(s) 63, 348
BshFI GGCC 1 cut(s) 179
BsiSI CCGG 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 175
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 1 cut(s) 179
Bsp143I GATC 2 cut(s) 34, 301
Bsp1720I GCTNAGC 1 cut(s) 278
BspANI GGCC 1 cut(s) 179
BsrI ACTGG 2 cut(s) 63, 348
BssMI GATC 2 cut(s) 34, 301
Bst2UI CCWGG 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 126
BstBAI YACGTR 1 cut(s) 352
BstC8I GCNNGC 2 cut(s) 258, 284
BstDEI CTNAG 1 cut(s) 278
BstF5I GGATG 2 cut(s) 199, 264
BstH2I RGCGCY 1 cut(s) 30
BstHHI GCGC 1 cut(s) 29
BstKTI GATC 2 cut(s) 37, 304
BstMBI GATC 2 cut(s) 34, 301
BstMWI GCNNNNNNNGC 1 cut(s) 283
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 260
BstSCI CCNGG 1 cut(s) 45
BstSFI CTRYAG 1 cut(s) 38
BstSNI TACGTA 1 cut(s) 352
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BsuRI GGCC 1 cut(s) 179
BtsCI GGATG 2 cut(s) 199, 264
Cac8I GCNNGC 2 cut(s) 258, 284
CaiI CAGNNNCTG 1 cut(s) 46
CfoI GCGC 1 cut(s) 29
Csp6I GTAC 1 cut(s) 349
CviAII CATG 3 cut(s) 64, 257, 269
CviJI RGCY 7 cut(s) 136, 179, 216, 277, 282, 286, 307
CviKI_1 RGCY 7 cut(s) 136, 179, 216, 277, 282, 286, 307
CviQI GTAC 1 cut(s) 349
DdeI CTNAG 1 cut(s) 278
DpnI GATC 2 cut(s) 36, 303
DpnII GATC 2 cut(s) 34, 301
Eco105I TACGTA 1 cut(s) 352
Eco147I AGGCCT 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 45
FaeI CATG 3 cut(s) 67, 260, 272
FaiI YATR 9 cut(s) 65, 104, 119, 129, 146, 183, 258, 270, 291
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FatI CATG 3 cut(s) 63, 256, 268
FbaI TGATCA 1 cut(s) 301
FokI GGATG 2 cut(s) 206, 251
FspBI CTAG 1 cut(s) 137
GlaI GCGC 1 cut(s) 28
GsuI CTGGAG 1 cut(s) 309
HaeII RGCGCY 1 cut(s) 30
HaeIII GGCC 1 cut(s) 179
HapII CCGG 1 cut(s) 82
HhaI GCGC 1 cut(s) 29
Hin1II CATG 3 cut(s) 67, 260, 272
Hin6I GCGC 1 cut(s) 27
HinP1I GCGC 1 cut(s) 27
HpaII CCGG 1 cut(s) 82
HphI GGTGA 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 3 cut(s) 18, 110, 359
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4IV ACGT 1 cut(s) 351
HpyCH4V TGCA 3 cut(s) 256, 260, 335
HpyF10VI GCNNNNNNNGC 1 cut(s) 283
HpyF3I CTNAG 1 cut(s) 278
HpySE526I ACGT 1 cut(s) 351
Hsp92II CATG 3 cut(s) 67, 260, 272
HspAI GCGC 1 cut(s) 27
Ksp22I TGATCA 1 cut(s) 301
Kzo9I GATC 2 cut(s) 34, 301
LmnI GCTCC 1 cut(s) 328
LpnPI CCDG 9 cut(s) 3, 32, 44, 59, 95, 287, 296, 329, 339
MaeI CTAG 1 cut(s) 137
MaeII ACGT 1 cut(s) 351
MalI GATC 2 cut(s) 36, 303
MboI GATC 2 cut(s) 34, 301
MboII GAAGA 2 cut(s) 20, 215
MflI RGATCY 1 cut(s) 34
MnlI CCTC 1 cut(s) 206
MspI CCGG 1 cut(s) 82
MspR9I CCNGG 1 cut(s) 47
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 283
NdeII GATC 2 cut(s) 34, 301
NlaIII CATG 3 cut(s) 67, 260, 272
NspI RCATGY 1 cut(s) 260
PaeI GCATGC 1 cut(s) 260
PceI AGGCCT 1 cut(s) 179
PctI GAATGC 1 cut(s) 163
Ppu21I YACGTR 1 cut(s) 352
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PstNI CAGNNNCTG 1 cut(s) 46
PsuI RGATCY 1 cut(s) 34
RsaI GTAC 1 cut(s) 350
RsaNI GTAC 1 cut(s) 349
Sau3AI GATC 2 cut(s) 34, 301
ScrFI CCNGG 1 cut(s) 47
SetI ASST 6 cut(s) 48, 79, 138, 151, 279, 354
SfcI CTRYAG 1 cut(s) 38
SnaBI TACGTA 1 cut(s) 352
SphI GCATGC 1 cut(s) 260
SseBI AGGCCT 1 cut(s) 179
SspMI CTAG 1 cut(s) 137
StuI AGGCCT 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 126
TaiI ACGT 1 cut(s) 354
TspDTI ATGAA 2 cut(s) 133, 216
XceI RCATGY 1 cut(s) 260
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.